Incidental Mutation 'R6875:Kif28'
ID536347
Institutional Source Beutler Lab
Gene Symbol Kif28
Ensembl Gene ENSMUSG00000087236
Gene Namekinesin family member 28
SynonymsLOC383592, Gm1305
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.434) question?
Stock #R6875 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location179695297-179745271 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 179735994 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 139 (I139T)
Ref Sequence ENSEMBL: ENSMUSP00000148289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000131716] [ENSMUST00000211943] [ENSMUST00000221136]
Predicted Effect possibly damaging
Transcript: ENSMUST00000131716
AA Change: I139T

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000118935
Gene: ENSMUSG00000087236
AA Change: I139T

DomainStartEndE-ValueType
KISc 3 331 1.02e-120 SMART
low complexity region 343 354 N/A INTRINSIC
FHA 424 473 1.12e-3 SMART
Pfam:KIF1B 615 654 1.3e-7 PFAM
low complexity region 842 857 N/A INTRINSIC
low complexity region 959 973 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211943
AA Change: I139T

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000221136
AA Change: I139T

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030458C11Rik T C 15: 12,812,068 H270R probably damaging Het
Abcb1a T C 5: 8,701,628 I336T probably benign Het
Adam19 T A 11: 46,112,875 F177I probably benign Het
Ankrd53 T C 6: 83,768,173 V455A probably damaging Het
Arrdc1 A G 2: 24,925,665 S415P probably benign Het
Atp10a T C 7: 58,797,352 L614P probably benign Het
C130060K24Rik A T 6: 65,456,336 N380I probably benign Het
Catsper1 G T 19: 5,343,963 V668F probably damaging Het
Cluh T A 11: 74,661,918 D596E probably damaging Het
Cnot10 A G 9: 114,615,107 S407P probably benign Het
Commd6 T C 14: 101,634,350 T86A probably damaging Het
D5Ertd579e A T 5: 36,604,657 probably null Het
Eif3l A G 15: 79,085,560 D252G probably damaging Het
Epha2 A T 4: 141,328,468 S962C probably damaging Het
Fcho1 C A 8: 71,714,425 probably null Het
Fgf23 G T 6: 127,073,216 G63C probably damaging Het
Flnc A T 6: 29,445,749 Y834F probably damaging Het
Gcn1l1 T C 5: 115,588,110 L608P probably damaging Het
Hdac5 T A 11: 102,202,276 E545V probably damaging Het
Hecw2 A T 1: 53,937,132 M166K probably benign Het
Ikbkb T C 8: 22,665,893 D586G probably damaging Het
Il1f9 G C 2: 24,188,621 probably null Het
Ipo13 A T 4: 117,904,911 I422N possibly damaging Het
Iqgap3 GGAGAG GGAG 3: 88,112,771 probably null Het
Kat6a G A 8: 22,932,361 A896T probably benign Het
Klhl25 A G 7: 75,866,342 E332G probably damaging Het
Krt8 C T 15: 101,997,908 A389T probably benign Het
Msrb3 T C 10: 120,784,106 S175G probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo10 T C 15: 25,805,659 Y1709H probably benign Het
Nckap5 A G 1: 126,023,194 S1519P probably benign Het
Npnt T A 3: 132,909,910 D124V probably damaging Het
Nr1d1 A T 11: 98,770,836 probably null Het
Ogdh A G 11: 6,340,477 Y365C probably benign Het
Olfr1305 A T 2: 111,872,961 I298N possibly damaging Het
Phf21b A T 15: 84,787,446 C416S probably damaging Het
Prpsap1 A G 11: 116,471,438 S373P probably damaging Het
Rab28 T C 5: 41,703,534 T26A probably damaging Het
Rbbp8nl A G 2: 180,279,226 I455T probably benign Het
Rnft2 G A 5: 118,228,818 A285V possibly damaging Het
Rrp36 G T 17: 46,672,371 Q106K probably benign Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn5a A G 9: 119,486,644 L1666P probably damaging Het
Siglecf A C 7: 43,355,200 T318P probably benign Het
Slc22a1 C T 17: 12,667,305 W147* probably null Het
Smchd1 T C 17: 71,353,506 I1868V probably damaging Het
Snx21 A G 2: 164,791,902 S203G probably damaging Het
Srl T C 16: 4,482,831 K792R probably benign Het
Srrt A G 5: 137,298,673 F100S probably benign Het
Stard9 G T 2: 120,697,436 M1391I probably benign Het
Syne2 A G 12: 76,035,630 E119G probably damaging Het
Syt11 G T 3: 88,762,155 S143R possibly damaging Het
Tiparp T A 3: 65,531,642 H126Q probably benign Het
Tulp2 C A 7: 45,518,614 T150K probably benign Het
Ugt2b37 T A 5: 87,242,429 Y386F probably benign Het
Usp31 C T 7: 121,649,640 W860* probably null Het
Zfp317 A G 9: 19,643,665 R30G probably damaging Het
Zfp709 C A 8: 71,889,007 N93K possibly damaging Het
Other mutations in Kif28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Kif28 APN 1 179702516 missense probably damaging 1.00
IGL00581:Kif28 APN 1 179739957 missense probably benign 0.14
R0348:Kif28 UTSW 1 179731253 missense probably damaging 1.00
R0388:Kif28 UTSW 1 179740089 missense possibly damaging 0.71
R0412:Kif28 UTSW 1 179702526 missense probably benign 0.01
R0788:Kif28 UTSW 1 179705223 unclassified probably benign
R0960:Kif28 UTSW 1 179695805 nonsense probably null
R1365:Kif28 UTSW 1 179739987 nonsense probably null
R1420:Kif28 UTSW 1 179702397 missense probably damaging 1.00
R1442:Kif28 UTSW 1 179705132 missense possibly damaging 0.73
R1507:Kif28 UTSW 1 179736006 missense probably damaging 1.00
R1818:Kif28 UTSW 1 179705754 missense possibly damaging 0.66
R1819:Kif28 UTSW 1 179705754 missense possibly damaging 0.66
R1903:Kif28 UTSW 1 179702523 missense possibly damaging 0.63
R2221:Kif28 UTSW 1 179733111 missense possibly damaging 0.80
R2358:Kif28 UTSW 1 179709459 missense probably damaging 1.00
R4916:Kif28 UTSW 1 179702520 missense probably benign 0.09
R4943:Kif28 UTSW 1 179713951 missense probably benign 0.02
R4967:Kif28 UTSW 1 179708442 missense probably damaging 1.00
R4974:Kif28 UTSW 1 179698644 missense probably damaging 0.98
R5152:Kif28 UTSW 1 179702538 missense probably damaging 1.00
R5382:Kif28 UTSW 1 179700282 missense probably damaging 1.00
R5649:Kif28 UTSW 1 179697771 splice site probably null
R5999:Kif28 UTSW 1 179695790 missense probably damaging 1.00
R6017:Kif28 UTSW 1 179699453 missense probably benign 0.24
R6180:Kif28 UTSW 1 179697772 splice site probably null
R7400:Kif28 UTSW 1 179700274 missense probably damaging 1.00
R7402:Kif28 UTSW 1 179740079 missense probably benign 0.00
R7530:Kif28 UTSW 1 179708480 missense probably benign 0.31
R7589:Kif28 UTSW 1 179731400 missense probably benign 0.01
R7648:Kif28 UTSW 1 179709424 missense possibly damaging 0.89
R7815:Kif28 UTSW 1 179735983 missense probably damaging 1.00
R8030:Kif28 UTSW 1 179699064 missense probably benign 0.04
R8050:Kif28 UTSW 1 179709449 missense probably benign 0.00
R8088:Kif28 UTSW 1 179700354 missense probably damaging 1.00
Z1176:Kif28 UTSW 1 179733134 missense probably benign 0.05
Z1177:Kif28 UTSW 1 179728219 missense not run
Predicted Primers PCR Primer
(F):5'- TACAGTCGATGGTGCCTTCC -3'
(R):5'- CCACTGGTGACATTTAACGGTATCG -3'

Sequencing Primer
(F):5'- TGTAATGAGATCTGACGCCC -3'
(R):5'- CGTTTCTAGAGCGATGTCTTCCATG -3'
Posted On2018-10-18