Incidental Mutation 'R6875:Snx21'
ID 536352
Institutional Source Beutler Lab
Gene Symbol Snx21
Ensembl Gene ENSMUSG00000050373
Gene Name sorting nexin family member 21
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6875 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 164785823-164793816 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 164791902 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 203 (S203G)
Ref Sequence ENSEMBL: ENSMUSP00000054137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017451] [ENSMUST00000056181] [ENSMUST00000103094] [ENSMUST00000134611] [ENSMUST00000152471] [ENSMUST00000172577] [ENSMUST00000174070]
AlphaFold Q3UR97
Predicted Effect probably benign
Transcript: ENSMUST00000017451
SMART Domains Protein: ENSMUSP00000017451
Gene: ENSMUSG00000017307

DomainStartEndE-ValueType
Pfam:Acyl_CoA_thio 38 132 4.6e-9 PFAM
Pfam:4HBT_3 45 255 8.8e-30 PFAM
Pfam:Acyl_CoA_thio 180 253 2.8e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000056181
AA Change: S203G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054137
Gene: ENSMUSG00000050373
AA Change: S203G

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 17 28 N/A INTRINSIC
low complexity region 58 69 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
PX 124 232 4.19e-10 SMART
low complexity region 249 263 N/A INTRINSIC
low complexity region 334 343 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103094
SMART Domains Protein: ENSMUSP00000099383
Gene: ENSMUSG00000017307

DomainStartEndE-ValueType
Pfam:Acyl_CoA_thio 39 132 5e-9 PFAM
Pfam:4HBT_3 45 309 2.7e-44 PFAM
Pfam:Acyl_CoA_thio 180 308 5.3e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134611
SMART Domains Protein: ENSMUSP00000133718
Gene: ENSMUSG00000017307

DomainStartEndE-ValueType
low complexity region 79 113 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140519
Predicted Effect probably benign
Transcript: ENSMUST00000152471
SMART Domains Protein: ENSMUSP00000133914
Gene: ENSMUSG00000050373

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 17 28 N/A INTRINSIC
low complexity region 58 69 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172577
SMART Domains Protein: ENSMUSP00000134133
Gene: ENSMUSG00000050373

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 17 28 N/A INTRINSIC
low complexity region 58 69 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174070
SMART Domains Protein: ENSMUSP00000133344
Gene: ENSMUSG00000050373

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 17 28 N/A INTRINSIC
low complexity region 58 69 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein does not contain a coiled coil region, like some family members. The specific function of this protein has not been determined. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030458C11Rik T C 15: 12,812,068 H270R probably damaging Het
Abcb1a T C 5: 8,701,628 I336T probably benign Het
Adam19 T A 11: 46,112,875 F177I probably benign Het
Ankrd53 T C 6: 83,768,173 V455A probably damaging Het
Arrdc1 A G 2: 24,925,665 S415P probably benign Het
Atp10a T C 7: 58,797,352 L614P probably benign Het
C130060K24Rik A T 6: 65,456,336 N380I probably benign Het
Catsper1 G T 19: 5,343,963 V668F probably damaging Het
Cluh T A 11: 74,661,918 D596E probably damaging Het
Cnot10 A G 9: 114,615,107 S407P probably benign Het
Commd6 T C 14: 101,634,350 T86A probably damaging Het
D5Ertd579e A T 5: 36,604,657 probably null Het
Eif3l A G 15: 79,085,560 D252G probably damaging Het
Epha2 A T 4: 141,328,468 S962C probably damaging Het
Fcho1 C A 8: 71,714,425 probably null Het
Fgf23 G T 6: 127,073,216 G63C probably damaging Het
Flnc A T 6: 29,445,749 Y834F probably damaging Het
Gcn1l1 T C 5: 115,588,110 L608P probably damaging Het
Hdac5 T A 11: 102,202,276 E545V probably damaging Het
Hecw2 A T 1: 53,937,132 M166K probably benign Het
Ikbkb T C 8: 22,665,893 D586G probably damaging Het
Il1f9 G C 2: 24,188,621 probably null Het
Ipo13 A T 4: 117,904,911 I422N possibly damaging Het
Iqgap3 GGAGAG GGAG 3: 88,112,771 probably null Het
Kat6a G A 8: 22,932,361 A896T probably benign Het
Kif28 A G 1: 179,735,994 I139T probably damaging Het
Klhl25 A G 7: 75,866,342 E332G probably damaging Het
Krt8 C T 15: 101,997,908 A389T probably benign Het
Msrb3 T C 10: 120,784,106 S175G probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo10 T C 15: 25,805,659 Y1709H probably benign Het
Nckap5 A G 1: 126,023,194 S1519P probably benign Het
Npnt T A 3: 132,909,910 D124V probably damaging Het
Nr1d1 A T 11: 98,770,836 probably null Het
Ogdh A G 11: 6,340,477 Y365C probably benign Het
Olfr1305 A T 2: 111,872,961 I298N possibly damaging Het
Phf21b A T 15: 84,787,446 C416S probably damaging Het
Prpsap1 A G 11: 116,471,438 S373P probably damaging Het
Rab28 T C 5: 41,703,534 T26A probably damaging Het
Rbbp8nl A G 2: 180,279,226 I455T probably benign Het
Rnft2 G A 5: 118,228,818 A285V possibly damaging Het
Rrp36 G T 17: 46,672,371 Q106K probably benign Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn5a A G 9: 119,486,644 L1666P probably damaging Het
Siglecf A C 7: 43,355,200 T318P probably benign Het
Slc22a1 C T 17: 12,667,305 W147* probably null Het
Smchd1 T C 17: 71,353,506 I1868V probably damaging Het
Srl T C 16: 4,482,831 K792R probably benign Het
Srrt A G 5: 137,298,673 F100S probably benign Het
Stard9 G T 2: 120,697,436 M1391I probably benign Het
Syne2 A G 12: 76,035,630 E119G probably damaging Het
Syt11 G T 3: 88,762,155 S143R possibly damaging Het
Tiparp T A 3: 65,531,642 H126Q probably benign Het
Tulp2 C A 7: 45,518,614 T150K probably benign Het
Ugt2b37 T A 5: 87,242,429 Y386F probably benign Het
Usp31 C T 7: 121,649,640 W860* probably null Het
Zfp317 A G 9: 19,643,665 R30G probably damaging Het
Zfp709 C A 8: 71,889,007 N93K possibly damaging Het
Other mutations in Snx21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Snx21 APN 2 164786220 missense probably damaging 1.00
IGL02329:Snx21 APN 2 164792390 utr 3 prime probably benign
R4162:Snx21 UTSW 2 164786850 missense probably damaging 1.00
R4164:Snx21 UTSW 2 164786850 missense probably damaging 1.00
R5092:Snx21 UTSW 2 164786746 missense probably damaging 0.99
R5262:Snx21 UTSW 2 164791821 missense probably damaging 0.99
R7231:Snx21 UTSW 2 164786201 missense probably benign 0.00
R7757:Snx21 UTSW 2 164786165 missense probably damaging 1.00
R8001:Snx21 UTSW 2 164786737 missense probably benign 0.03
R8341:Snx21 UTSW 2 164791885 missense probably damaging 1.00
R8796:Snx21 UTSW 2 164786829 missense possibly damaging 0.53
R9340:Snx21 UTSW 2 164791929 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- GAGGTTTTACATCAGCCCTGAC -3'
(R):5'- AAGGATGGGGTCTCTTGTCC -3'

Sequencing Primer
(F):5'- TACACCCTCGCCGTGATG -3'
(R):5'- GGATCCTCCAGCTCCTGATG -3'
Posted On 2018-10-18