Mutagenetix > Incidental Mutation

Incidental Mutation 'R6875:Syt11'

536356

Institutional Source

Beutler Lab

Gene Symbol

Syt11

Ensembl Gene

ENSMUSG00000068923

Gene Name

synaptotagmin XI

Synonyms

6530420C11Rik

MMRRC Submission

044971-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.393) question?

Stock #

R6875 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

88744700-88775164 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 88762155 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 143 (S143R)

Ref Sequence

ENSEMBL: ENSMUSP00000103129 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090945] [ENSMUST00000107505]

AlphaFold

Q9R0N3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000090945
AA Change: S143R

PolyPhen 2 Score 0.836 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000088464
Gene: ENSMUSG00000068923
AA Change: S143R

Domain	Start	End	E-Value	Type
transmembrane domain	15	37	N/A	INTRINSIC
low complexity region	72	83	N/A	INTRINSIC
C2	172	276	2.36e-17	SMART
C2	306	422	1.37e-22	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107505
AA Change: S143R

PolyPhen 2 Score 0.836 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000103129
Gene: ENSMUSG00000068923
AA Change: S143R

Domain	Start	End	E-Value	Type
transmembrane domain	15	37	N/A	INTRINSIC
low complexity region	72	83	N/A	INTRINSIC
C2	172	276	2.36e-17	SMART
C2	306	422	1.37e-22	SMART

Predicted Effect

Meta Mutation Damage Score

0.0768

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.2%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the synaptotagmin gene family and encodes a protein similar to other family members that are known calcium sensors and mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. The encoded protein is also a substrate for ubiquitin-E3-ligase parkin. The gene has previously been referred to as synaptotagmin XII but has been renamed synaptotagmin XI to be consistent with mouse and rat official nomenclature. [provided by RefSeq, Apr 2010]
PHENOTYPE: Homozygous mutation of this gene results in no obvious abnormal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6030458C11Rik	T	C	15: 12,812,068	H270R	probably damaging	Het
Abcb1a	T	C	5: 8,701,628	I336T	probably benign	Het
Adam19	T	A	11: 46,112,875	F177I	probably benign	Het
Ankrd53	T	C	6: 83,768,173	V455A	probably damaging	Het
Arrdc1	A	G	2: 24,925,665	S415P	probably benign	Het
Atp10a	T	C	7: 58,797,352	L614P	probably benign	Het
C130060K24Rik	A	T	6: 65,456,336	N380I	probably benign	Het
Catsper1	G	T	19: 5,343,963	V668F	probably damaging	Het
Cluh	T	A	11: 74,661,918	D596E	probably damaging	Het
Cnot10	A	G	9: 114,615,107	S407P	probably benign	Het
Commd6	T	C	14: 101,634,350	T86A	probably damaging	Het
D5Ertd579e	A	T	5: 36,604,657		probably null	Het
Eif3l	A	G	15: 79,085,560	D252G	probably damaging	Het
Epha2	A	T	4: 141,328,468	S962C	probably damaging	Het
Fcho1	C	A	8: 71,714,425		probably null	Het
Fgf23	G	T	6: 127,073,216	G63C	probably damaging	Het
Flnc	A	T	6: 29,445,749	Y834F	probably damaging	Het
Gcn1l1	T	C	5: 115,588,110	L608P	probably damaging	Het
Hdac5	T	A	11: 102,202,276	E545V	probably damaging	Het
Hecw2	A	T	1: 53,937,132	M166K	probably benign	Het
Ikbkb	T	C	8: 22,665,893	D586G	probably damaging	Het
Il1f9	G	C	2: 24,188,621		probably null	Het
Ipo13	A	T	4: 117,904,911	I422N	possibly damaging	Het
Iqgap3	GGAGAG	GGAG	3: 88,112,771		probably null	Het
Kat6a	G	A	8: 22,932,361	A896T	probably benign	Het
Kif28	A	G	1: 179,735,994	I139T	probably damaging	Het
Klhl25	A	G	7: 75,866,342	E332G	probably damaging	Het
Krt8	C	T	15: 101,997,908	A389T	probably benign	Het
Msrb3	T	C	10: 120,784,106	S175G	probably benign	Het
Muc5ac	C	T	7: 141,809,744		probably benign	Het
Myo10	T	C	15: 25,805,659	Y1709H	probably benign	Het
Nckap5	A	G	1: 126,023,194	S1519P	probably benign	Het
Npnt	T	A	3: 132,909,910	D124V	probably damaging	Het
Nr1d1	A	T	11: 98,770,836		probably null	Het
Ogdh	A	G	11: 6,340,477	Y365C	probably benign	Het
Olfr1305	A	T	2: 111,872,961	I298N	possibly damaging	Het
Phf21b	A	T	15: 84,787,446	C416S	probably damaging	Het
Prpsap1	A	G	11: 116,471,438	S373P	probably damaging	Het
Rab28	T	C	5: 41,703,534	T26A	probably damaging	Het
Rbbp8nl	A	G	2: 180,279,226	I455T	probably benign	Het
Rnft2	G	A	5: 118,228,818	A285V	possibly damaging	Het
Rrp36	G	T	17: 46,672,371	Q106K	probably benign	Het
Rsf1	CG	CGACGGCGGAG	7: 97,579,908		probably benign	Het
Runx2	G	A	17: 44,814,192	P80L	probably damaging	Het
Scn5a	A	G	9: 119,486,644	L1666P	probably damaging	Het
Siglecf	A	C	7: 43,355,200	T318P	probably benign	Het
Slc22a1	C	T	17: 12,667,305	W147*	probably null	Het
Smchd1	T	C	17: 71,353,506	I1868V	probably damaging	Het
Snx21	A	G	2: 164,791,902	S203G	probably damaging	Het
Srl	T	C	16: 4,482,831	K792R	probably benign	Het
Srrt	A	G	5: 137,298,673	F100S	probably benign	Het
Stard9	G	T	2: 120,697,436	M1391I	probably benign	Het
Syne2	A	G	12: 76,035,630	E119G	probably damaging	Het
Tiparp	T	A	3: 65,531,642	H126Q	probably benign	Het
Tulp2	C	A	7: 45,518,614	T150K	probably benign	Het
Ugt2b37	T	A	5: 87,242,429	Y386F	probably benign	Het
Usp31	C	T	7: 121,649,640	W860*	probably null	Het
Zfp317	A	G	9: 19,643,665	R30G	probably damaging	Het
Zfp709	C	A	8: 71,889,007	N93K	possibly damaging	Het

Other mutations in Syt11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01402:Syt11	APN	3	88762216	missense	probably benign	0.01
IGL01404:Syt11	APN	3	88762216	missense	probably benign	0.01
IGL03031:Syt11	APN	3	88748841	start codon destroyed	probably null	0.06
R0041:Syt11	UTSW	3	88747903	missense	probably damaging	1.00
R0326:Syt11	UTSW	3	88762548	missense	possibly damaging	0.71
R0569:Syt11	UTSW	3	88747923	missense	probably benign	0.02
R0613:Syt11	UTSW	3	88762469	missense	probably damaging	1.00
R1209:Syt11	UTSW	3	88747840	missense	probably damaging	1.00
R1417:Syt11	UTSW	3	88761982	missense	probably damaging	1.00
R1530:Syt11	UTSW	3	88762367	missense	probably damaging	1.00
R1544:Syt11	UTSW	3	88748803	missense	probably benign	0.00
R1727:Syt11	UTSW	3	88761952	missense	possibly damaging	0.92
R4952:Syt11	UTSW	3	88762283	missense	possibly damaging	0.85
R5097:Syt11	UTSW	3	88747924	missense	probably benign	0.01
R5162:Syt11	UTSW	3	88747842	missense	probably damaging	1.00
R6024:Syt11	UTSW	3	88762109	missense	probably benign
R7013:Syt11	UTSW	3	88747989	missense	possibly damaging	0.82
R7761:Syt11	UTSW	3	88762471	missense	possibly damaging	0.68
R8218:Syt11	UTSW	3	88762120	missense	probably benign	0.01
R8833:Syt11	UTSW	3	88747842	missense	probably damaging	1.00
R8898:Syt11	UTSW	3	88762028	missense	probably benign	0.02
R8933:Syt11	UTSW	3	88747704	missense	probably damaging	1.00
R8937:Syt11	UTSW	3	88747744	missense	probably damaging	1.00
R9127:Syt11	UTSW	3	88762336	missense	probably benign
R9605:Syt11	UTSW	3	88762018	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- TGAAGGTCTCATCGAACACC -3'
(R):5'- GAGAGACAAAGATGGCCCTC -3'

Sequencing Primer
(F):5'- GAAGCACTCGGGTCTTCACTC -3'
(R):5'- CAAAGATGGCCCTCGGAGG -3'

Posted On

2018-10-18