Incidental Mutation 'R6875:Abcb1a'

• ID: 536360
• Institutional Source: Beutler Lab
• Gene Symbol: Abcb1a
• Ensembl Gene: ENSMUSG00000040584
• Gene Name: ATP-binding cassette, sub-family B (MDR/TAP), member 1A
• Synonyms: Pgp, mdr-3, Pgy-3, MDR3, P-glycoprotein, Evi32, P-gp, Mdr1a, Pgy3, multiple drug resistant 1a
• MMRRC Submission: 044971-MU
• Essential gene?: Probably non essential (E-score: 0.141)
• Stock #: R6875 (G1)
• Quality Score: 225.009
• Status: Validated
• Chromosome: 5
• Chromosomal Location: 8660077-8748575 bp(+) (GRCm38)
• Type of Mutation: missense
• DNA Base Change (assembly): T to C at 8701628 bp (GRCm38)
• Zygosity: Heterozygous
• Amino Acid Change: Isoleucine to Threonine at position 336 (I336T)
• Ref Sequence: ENSEMBL: ENSMUSP00000041204
• Gene Model: predicted gene model for transcript(s): [ENSMUST00000047753]
• AlphaFold: P21447
• PDB Structure: Structure of P-glycoprotein Reveals a Molecular Basis for Poly-Specific Drug Binding [X-RAY DIFFRACTION] ; Structure of P-glycoprotein Reveals a Molecular Basis for Poly-Specific Drug Binding [X-RAY DIFFRACTION] ; Structure of P-glycoprotein Reveals a Molecular Basis for Poly-Specific Drug Binding [X-RAY DIFFRACTION] ; Structures of P-glycoprotein reveal its conformational flexibility and an epitope on the nucleotide-binding domain [X-RAY DIFFRACTION] ; Structures of P-glycoprotein reveal its conformational flexibility and an epitope on the nucleotide-binding domain [X-RAY DIFFRACTION] ; Structures of P-glycoprotein reveal its conformational flexibility and an epitope on the nucleotide-binding domain [X-RAY DIFFRACTION] ; Structure of Mouse P-Glycoprotein [X-RAY DIFFRACTION] ; Corrected Structure of Mouse P-glycoprotein [X-RAY DIFFRACTION] ; Corrected Structure of Mouse P-glycoprotein bound to QZ59-RRR [X-RAY DIFFRACTION] ; Corrected Structure of Mouse P-glycoprotein bound to QZ59-SSS [X-RAY DIFFRACTION] ; >> 5 additional structures at PDB <<
• Predicted Effect: probably benign; Transcript: ENSMUST00000047753; AA Change: I336T; PolyPhen 2 Score 0.277 (Sensitivity: 0.91; Specificity: 0.88)
• SMART Domains: Protein: ENSMUSP00000041204; Gene: ENSMUSG00000040584; AA Change: I336T

Domain	Start	End	E-Value	Type
low complexity region	16	30	N/A	INTRINSIC
Pfam:ABC_membrane	50	339	8.3e-97	PFAM
AAA	415	607	1.22e-20	SMART
Pfam:ABC_membrane	707	982	4.8e-79	PFAM
AAA	1058	1246	8.85e-18	SMART

• Coding Region Coverage:
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
• Validation Efficiency: 98% (58/59)
• MGI Phenotype: FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This gene encodes a p-glycoprotein which actively transports a variety of hydrophobic amphipathic drugs and plays a major role in the blood-brain barrier permeability of certain drugs. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mutations in this gene result in increased sensitivity to various drugs, including avermectins and vinblastine. Mice with a null allele develop spontanous colitis. [provided by MGI curators]
• Posted On: 2018-10-18

Predicted Primers

PCR Primer
(F):5'- TACTCATAGAGCTTGTATGTCACAG -3'
(R):5'- TACAGCAACTGTGTGATAAGCTAC -3'

Sequencing Primer
(F):5'- TCCATACAAGGTGGAATGGTTATG -3'
(R):5'- GCAACTGTGTGATAAGCTACATAAC -3'