Incidental Mutation 'R6875:Rab28'
ID536362
Institutional Source Beutler Lab
Gene Symbol Rab28
Ensembl Gene ENSMUSG00000029128
Gene NameRAB28, member RAS oncogene family
Synonyms2700023P08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R6875 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location41624976-41708157 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41703534 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 26 (T26A)
Ref Sequence ENSEMBL: ENSMUSP00000144440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031011] [ENSMUST00000201422] [ENSMUST00000202913]
Predicted Effect probably damaging
Transcript: ENSMUST00000031011
AA Change: T26A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031011
Gene: ENSMUSG00000029128
AA Change: T26A

DomainStartEndE-ValueType
Pfam:Arf 3 177 1.1e-13 PFAM
Pfam:Roc 14 133 9e-28 PFAM
Pfam:Gtr1_RagA 14 178 3.2e-7 PFAM
Pfam:Ras 14 179 3.3e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000201422
AA Change: T26A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144541
Gene: ENSMUSG00000029128
AA Change: T26A

DomainStartEndE-ValueType
small_GTPase 10 180 1.3e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202913
AA Change: T26A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144440
Gene: ENSMUSG00000029128
AA Change: T26A

DomainStartEndE-ValueType
Pfam:Arf 3 176 6e-14 PFAM
Pfam:Roc 14 133 4.8e-28 PFAM
Pfam:Gtr1_RagA 14 177 1.7e-7 PFAM
Pfam:Ras 14 179 1.8e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rab subfamily of Ras-related small GTPases. The encoded protein may be involved in regulating intracellular trafficking. Alternative splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 9 and X. [provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030458C11Rik T C 15: 12,812,068 H270R probably damaging Het
Abcb1a T C 5: 8,701,628 I336T probably benign Het
Adam19 T A 11: 46,112,875 F177I probably benign Het
Ankrd53 T C 6: 83,768,173 V455A probably damaging Het
Arrdc1 A G 2: 24,925,665 S415P probably benign Het
Atp10a T C 7: 58,797,352 L614P probably benign Het
C130060K24Rik A T 6: 65,456,336 N380I probably benign Het
Catsper1 G T 19: 5,343,963 V668F probably damaging Het
Cluh T A 11: 74,661,918 D596E probably damaging Het
Cnot10 A G 9: 114,615,107 S407P probably benign Het
Commd6 T C 14: 101,634,350 T86A probably damaging Het
D5Ertd579e A T 5: 36,604,657 probably null Het
Eif3l A G 15: 79,085,560 D252G probably damaging Het
Epha2 A T 4: 141,328,468 S962C probably damaging Het
Fcho1 C A 8: 71,714,425 probably null Het
Fgf23 G T 6: 127,073,216 G63C probably damaging Het
Flnc A T 6: 29,445,749 Y834F probably damaging Het
Gcn1l1 T C 5: 115,588,110 L608P probably damaging Het
Hdac5 T A 11: 102,202,276 E545V probably damaging Het
Hecw2 A T 1: 53,937,132 M166K probably benign Het
Ikbkb T C 8: 22,665,893 D586G probably damaging Het
Il1f9 G C 2: 24,188,621 probably null Het
Ipo13 A T 4: 117,904,911 I422N possibly damaging Het
Iqgap3 GGAGAG GGAG 3: 88,112,771 probably null Het
Kat6a G A 8: 22,932,361 A896T probably benign Het
Kif28 A G 1: 179,735,994 I139T probably damaging Het
Klhl25 A G 7: 75,866,342 E332G probably damaging Het
Krt8 C T 15: 101,997,908 A389T probably benign Het
Msrb3 T C 10: 120,784,106 S175G probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo10 T C 15: 25,805,659 Y1709H probably benign Het
Nckap5 A G 1: 126,023,194 S1519P probably benign Het
Npnt T A 3: 132,909,910 D124V probably damaging Het
Nr1d1 A T 11: 98,770,836 probably null Het
Ogdh A G 11: 6,340,477 Y365C probably benign Het
Olfr1305 A T 2: 111,872,961 I298N possibly damaging Het
Phf21b A T 15: 84,787,446 C416S probably damaging Het
Prpsap1 A G 11: 116,471,438 S373P probably damaging Het
Rbbp8nl A G 2: 180,279,226 I455T probably benign Het
Rnft2 G A 5: 118,228,818 A285V possibly damaging Het
Rrp36 G T 17: 46,672,371 Q106K probably benign Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn5a A G 9: 119,486,644 L1666P probably damaging Het
Siglecf A C 7: 43,355,200 T318P probably benign Het
Slc22a1 C T 17: 12,667,305 W147* probably null Het
Smchd1 T C 17: 71,353,506 I1868V probably damaging Het
Snx21 A G 2: 164,791,902 S203G probably damaging Het
Srl T C 16: 4,482,831 K792R probably benign Het
Srrt A G 5: 137,298,673 F100S probably benign Het
Stard9 G T 2: 120,697,436 M1391I probably benign Het
Syne2 A G 12: 76,035,630 E119G probably damaging Het
Syt11 G T 3: 88,762,155 S143R possibly damaging Het
Tiparp T A 3: 65,531,642 H126Q probably benign Het
Tulp2 C A 7: 45,518,614 T150K probably benign Het
Ugt2b37 T A 5: 87,242,429 Y386F probably benign Het
Usp31 C T 7: 121,649,640 W860* probably null Het
Zfp317 A G 9: 19,643,665 R30G probably damaging Het
Zfp709 C A 8: 71,889,007 N93K possibly damaging Het
Other mutations in Rab28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Rab28 APN 5 41703456 missense probably benign 0.30
IGL01125:Rab28 APN 5 41635894 missense probably benign 0.01
IGL01413:Rab28 APN 5 41698447 missense probably damaging 1.00
R1005:Rab28 UTSW 5 41698383 splice site probably benign
R1606:Rab28 UTSW 5 41698452 missense probably damaging 1.00
R1940:Rab28 UTSW 5 41625790 missense probably benign 0.00
R6243:Rab28 UTSW 5 41635880 missense probably benign 0.00
R6977:Rab28 UTSW 5 41698392 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCTGTGAGACTTATATAACCTCACAC -3'
(R):5'- AAGTGCAGTCAGTATTCCTGGG -3'

Sequencing Primer
(F):5'- CCTCACACAGGTAAGGTTCTATAGTC -3'
(R):5'- ATAAGTTTAGAGGTGTTCTTATG -3'
Posted On2018-10-18