Mutagenetix > Incidental Mutation

Incidental Mutation 'R6875:Gcn1l1'

536364

Institutional Source

Beutler Lab

Gene Symbol

Gcn1l1

Ensembl Gene

ENSMUSG00000041638

Gene Name

GCN1 general control of amino-acid synthesis 1-like 1 (yeast)

Synonyms

GCN1L, G431004K08Rik

MMRRC Submission

044971-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.927) question?

Stock #

R6875 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

115565254-115622654 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 115588110 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 608 (L608P)

Ref Sequence

ENSEMBL: ENSMUSP00000069432 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064454]

AlphaFold

E9PVA8

Predicted Effect

probably damaging
Transcript: ENSMUST00000064454
AA Change: L608P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000069432
Gene: ENSMUSG00000041638
AA Change: L608P

Domain	Start	End	E-Value	Type
low complexity region	64	84	N/A	INTRINSIC
low complexity region	108	117	N/A	INTRINSIC
low complexity region	142	154	N/A	INTRINSIC
Pfam:DUF3554	357	705	2e-61	PFAM
coiled coil region	806	866	N/A	INTRINSIC
Blast:ARM	1028	1068	6e-11	BLAST
coiled coil region	1180	1203	N/A	INTRINSIC
low complexity region	1457	1466	N/A	INTRINSIC
low complexity region	1501	1510	N/A	INTRINSIC
ARM	1527	1567	3.69e1	SMART
Blast:ARM	1602	1644	1e-5	BLAST
Blast:EZ_HEAT	1671	1704	1e-7	BLAST
low complexity region	1926	1934	N/A	INTRINSIC
low complexity region	1956	1972	N/A	INTRINSIC
ARM	2034	2070	9.27e1	SMART
low complexity region	2326	2334	N/A	INTRINSIC
ARM	2416	2455	2.16e1	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.2%

Validation Efficiency

98% (58/59)

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6030458C11Rik	T	C	15: 12,812,068	H270R	probably damaging	Het
Abcb1a	T	C	5: 8,701,628	I336T	probably benign	Het
Adam19	T	A	11: 46,112,875	F177I	probably benign	Het
Ankrd53	T	C	6: 83,768,173	V455A	probably damaging	Het
Arrdc1	A	G	2: 24,925,665	S415P	probably benign	Het
Atp10a	T	C	7: 58,797,352	L614P	probably benign	Het
C130060K24Rik	A	T	6: 65,456,336	N380I	probably benign	Het
Catsper1	G	T	19: 5,343,963	V668F	probably damaging	Het
Cluh	T	A	11: 74,661,918	D596E	probably damaging	Het
Cnot10	A	G	9: 114,615,107	S407P	probably benign	Het
Commd6	T	C	14: 101,634,350	T86A	probably damaging	Het
D5Ertd579e	A	T	5: 36,604,657		probably null	Het
Eif3l	A	G	15: 79,085,560	D252G	probably damaging	Het
Epha2	A	T	4: 141,328,468	S962C	probably damaging	Het
Fcho1	C	A	8: 71,714,425		probably null	Het
Fgf23	G	T	6: 127,073,216	G63C	probably damaging	Het
Flnc	A	T	6: 29,445,749	Y834F	probably damaging	Het
Hdac5	T	A	11: 102,202,276	E545V	probably damaging	Het
Hecw2	A	T	1: 53,937,132	M166K	probably benign	Het
Ikbkb	T	C	8: 22,665,893	D586G	probably damaging	Het
Il1f9	G	C	2: 24,188,621		probably null	Het
Ipo13	A	T	4: 117,904,911	I422N	possibly damaging	Het
Iqgap3	GGAGAG	GGAG	3: 88,112,771		probably null	Het
Kat6a	G	A	8: 22,932,361	A896T	probably benign	Het
Kif28	A	G	1: 179,735,994	I139T	probably damaging	Het
Klhl25	A	G	7: 75,866,342	E332G	probably damaging	Het
Krt8	C	T	15: 101,997,908	A389T	probably benign	Het
Msrb3	T	C	10: 120,784,106	S175G	probably benign	Het
Muc5ac	C	T	7: 141,809,744		probably benign	Het
Myo10	T	C	15: 25,805,659	Y1709H	probably benign	Het
Nckap5	A	G	1: 126,023,194	S1519P	probably benign	Het
Npnt	T	A	3: 132,909,910	D124V	probably damaging	Het
Nr1d1	A	T	11: 98,770,836		probably null	Het
Ogdh	A	G	11: 6,340,477	Y365C	probably benign	Het
Olfr1305	A	T	2: 111,872,961	I298N	possibly damaging	Het
Phf21b	A	T	15: 84,787,446	C416S	probably damaging	Het
Prpsap1	A	G	11: 116,471,438	S373P	probably damaging	Het
Rab28	T	C	5: 41,703,534	T26A	probably damaging	Het
Rbbp8nl	A	G	2: 180,279,226	I455T	probably benign	Het
Rnft2	G	A	5: 118,228,818	A285V	possibly damaging	Het
Rrp36	G	T	17: 46,672,371	Q106K	probably benign	Het
Rsf1	CG	CGACGGCGGAG	7: 97,579,908		probably benign	Het
Runx2	G	A	17: 44,814,192	P80L	probably damaging	Het
Scn5a	A	G	9: 119,486,644	L1666P	probably damaging	Het
Siglecf	A	C	7: 43,355,200	T318P	probably benign	Het
Slc22a1	C	T	17: 12,667,305	W147*	probably null	Het
Smchd1	T	C	17: 71,353,506	I1868V	probably damaging	Het
Snx21	A	G	2: 164,791,902	S203G	probably damaging	Het
Srl	T	C	16: 4,482,831	K792R	probably benign	Het
Srrt	A	G	5: 137,298,673	F100S	probably benign	Het
Stard9	G	T	2: 120,697,436	M1391I	probably benign	Het
Syne2	A	G	12: 76,035,630	E119G	probably damaging	Het
Syt11	G	T	3: 88,762,155	S143R	possibly damaging	Het
Tiparp	T	A	3: 65,531,642	H126Q	probably benign	Het
Tulp2	C	A	7: 45,518,614	T150K	probably benign	Het
Ugt2b37	T	A	5: 87,242,429	Y386F	probably benign	Het
Usp31	C	T	7: 121,649,640	W860*	probably null	Het
Zfp317	A	G	9: 19,643,665	R30G	probably damaging	Het
Zfp709	C	A	8: 71,889,007	N93K	possibly damaging	Het

Other mutations in Gcn1l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00869:Gcn1l1	APN	5	115588143	splice site	probably benign
IGL00974:Gcn1l1	APN	5	115613793	missense	possibly damaging	0.88
IGL01566:Gcn1l1	APN	5	115611058	missense	probably damaging	1.00
IGL01843:Gcn1l1	APN	5	115619700	missense	probably damaging	1.00
IGL01885:Gcn1l1	APN	5	115576115	splice site	probably null
IGL02081:Gcn1l1	APN	5	115585871	missense	probably damaging	1.00
IGL02118:Gcn1l1	APN	5	115610879	missense	probably damaging	1.00
IGL02150:Gcn1l1	APN	5	115609868	missense	probably damaging	1.00
IGL02190:Gcn1l1	APN	5	115614124	missense	probably damaging	1.00
IGL02219:Gcn1l1	APN	5	115613767	missense	possibly damaging	0.68
IGL02507:Gcn1l1	APN	5	115585881	missense	probably benign	0.11
IGL02644:Gcn1l1	APN	5	115575191	missense	probably benign
IGL02678:Gcn1l1	APN	5	115613755	missense	probably damaging	0.99
IGL02748:Gcn1l1	APN	5	115610800	splice site	probably null
IGL02755:Gcn1l1	APN	5	115604006	splice site	probably null
IGL02896:Gcn1l1	APN	5	115619648	splice site	probably benign
cusp	UTSW	5	115611060	missense	probably damaging	1.00
farthing	UTSW	5	115576108	splice site	probably benign
IGL03147:Gcn1l1	UTSW	5	115610858	missense	possibly damaging	0.78
R0362:Gcn1l1	UTSW	5	115576108	splice site	probably benign
R0540:Gcn1l1	UTSW	5	115588956	missense	probably benign	0.00
R0569:Gcn1l1	UTSW	5	115595059	missense	probably benign	0.00
R0570:Gcn1l1	UTSW	5	115592421	missense	probably damaging	1.00
R0584:Gcn1l1	UTSW	5	115595015	missense	probably damaging	1.00
R0630:Gcn1l1	UTSW	5	115581089	missense	probably benign	0.06
R0656:Gcn1l1	UTSW	5	115589303	missense	probably benign	0.27
R0801:Gcn1l1	UTSW	5	115591006	missense	probably benign	0.12
R0890:Gcn1l1	UTSW	5	115579793	missense	possibly damaging	0.77
R1400:Gcn1l1	UTSW	5	115614161	missense	probably damaging	1.00
R1485:Gcn1l1	UTSW	5	115574617	missense	probably benign
R1574:Gcn1l1	UTSW	5	115615552	missense	probably benign
R1574:Gcn1l1	UTSW	5	115615552	missense	probably benign
R1673:Gcn1l1	UTSW	5	115582297	missense	probably benign
R1894:Gcn1l1	UTSW	5	115589115	missense	probably damaging	1.00
R2114:Gcn1l1	UTSW	5	115598825	missense	probably benign	0.35
R2116:Gcn1l1	UTSW	5	115598825	missense	probably benign	0.35
R2117:Gcn1l1	UTSW	5	115598825	missense	probably benign	0.35
R2152:Gcn1l1	UTSW	5	115609829	missense	probably benign	0.07
R2162:Gcn1l1	UTSW	5	115592132	missense	probably benign	0.18
R2216:Gcn1l1	UTSW	5	115593661	missense	probably benign
R2218:Gcn1l1	UTSW	5	115619661	missense	probably benign	0.04
R2278:Gcn1l1	UTSW	5	115611175	missense	probably damaging	1.00
R2280:Gcn1l1	UTSW	5	115612730	missense	probably damaging	1.00
R3719:Gcn1l1	UTSW	5	115579817	missense	probably benign	0.03
R3729:Gcn1l1	UTSW	5	115583394	splice site	probably benign
R3833:Gcn1l1	UTSW	5	115592132	missense	probably benign	0.18
R3932:Gcn1l1	UTSW	5	115587834	missense	probably benign	0.11
R4067:Gcn1l1	UTSW	5	115599088	missense	probably damaging	1.00
R4152:Gcn1l1	UTSW	5	115613354	critical splice acceptor site	probably null
R4179:Gcn1l1	UTSW	5	115588050	missense	probably benign	0.00
R4292:Gcn1l1	UTSW	5	115576148	missense	possibly damaging	0.49
R4350:Gcn1l1	UTSW	5	115603330	missense	probably damaging	1.00
R4493:Gcn1l1	UTSW	5	115594144	missense	probably benign
R4672:Gcn1l1	UTSW	5	115606520	missense	probably damaging	1.00
R4749:Gcn1l1	UTSW	5	115614402	missense	probably benign
R4753:Gcn1l1	UTSW	5	115616478	missense	probably benign
R4826:Gcn1l1	UTSW	5	115593693	missense	probably benign
R4873:Gcn1l1	UTSW	5	115576170	missense	possibly damaging	0.92
R4875:Gcn1l1	UTSW	5	115576170	missense	possibly damaging	0.92
R4932:Gcn1l1	UTSW	5	115592144	missense	probably benign	0.00
R4992:Gcn1l1	UTSW	5	115599166	missense	probably benign	0.29
R5049:Gcn1l1	UTSW	5	115606671	missense	probably damaging	1.00
R5211:Gcn1l1	UTSW	5	115619312	missense	probably benign	0.04
R5226:Gcn1l1	UTSW	5	115588067	missense	probably benign	0.01
R5338:Gcn1l1	UTSW	5	115583403	missense	probably benign	0.00
R5914:Gcn1l1	UTSW	5	115610135	synonymous	silent
R5932:Gcn1l1	UTSW	5	115592376	missense	possibly damaging	0.77
R6422:Gcn1l1	UTSW	5	115609544	missense	probably damaging	1.00
R6435:Gcn1l1	UTSW	5	115611022	critical splice acceptor site	probably null
R6607:Gcn1l1	UTSW	5	115609478	missense	probably damaging	0.98
R6724:Gcn1l1	UTSW	5	115609158	splice site	probably null
R6861:Gcn1l1	UTSW	5	115611049	missense	probably benign
R6910:Gcn1l1	UTSW	5	115606538	missense	probably benign	0.42
R6975:Gcn1l1	UTSW	5	115613459	missense	probably damaging	1.00
R7027:Gcn1l1	UTSW	5	115616546	critical splice donor site	probably null
R7038:Gcn1l1	UTSW	5	115611144	missense	probably damaging	1.00
R7171:Gcn1l1	UTSW	5	115590293	missense	probably benign	0.02
R7276:Gcn1l1	UTSW	5	115611060	missense	probably damaging	1.00
R7456:Gcn1l1	UTSW	5	115604946	nonsense	probably null
R7473:Gcn1l1	UTSW	5	115581804	missense	probably benign	0.09
R7517:Gcn1l1	UTSW	5	115619696	missense	probably benign	0.01
R7714:Gcn1l1	UTSW	5	115595300	missense	probably damaging	0.97
R7752:Gcn1l1	UTSW	5	115615568	missense	probably damaging	1.00
R7812:Gcn1l1	UTSW	5	115593692	missense	possibly damaging	0.91
R7922:Gcn1l1	UTSW	5	115614468	missense	probably benign
R8070:Gcn1l1	UTSW	5	115588998	missense	probably benign	0.09
R8218:Gcn1l1	UTSW	5	115581529	missense	probably benign	0.00
R8329:Gcn1l1	UTSW	5	115609862	missense	probably damaging	0.99
R8413:Gcn1l1	UTSW	5	115579639	missense	probably benign	0.00
R8795:Gcn1l1	UTSW	5	115614395	missense	probably benign	0.02
R8802:Gcn1l1	UTSW	5	115609883	missense	probably damaging	1.00
R8899:Gcn1l1	UTSW	5	115579161	missense	probably benign	0.04
R8946:Gcn1l1	UTSW	5	115595345	missense	probably benign	0.02
R8963:Gcn1l1	UTSW	5	115589094	missense	probably benign	0.25
R9006:Gcn1l1	UTSW	5	115581507	missense	probably benign	0.22
R9163:Gcn1l1	UTSW	5	115604885	missense	probably benign
R9177:Gcn1l1	UTSW	5	115581808	missense	probably benign	0.35
R9187:Gcn1l1	UTSW	5	115614118	missense	probably damaging	1.00
R9411:Gcn1l1	UTSW	5	115595039	missense	possibly damaging	0.87
R9541:Gcn1l1	UTSW	5	115616357	missense	probably benign	0.00
R9574:Gcn1l1	UTSW	5	115575282	missense	possibly damaging	0.89
R9630:Gcn1l1	UTSW	5	115603290	missense	probably damaging	0.99
R9651:Gcn1l1	UTSW	5	115609606	critical splice donor site	probably null
R9761:Gcn1l1	UTSW	5	115591005	missense	probably benign	0.05
R9765:Gcn1l1	UTSW	5	115597072	nonsense	probably null
Z1177:Gcn1l1	UTSW	5	115614149	missense	probably damaging	0.99
Z1191:Gcn1l1	UTSW	5	115575293	missense	possibly damaging	0.76

Predicted Primers

PCR Primer
(F):5'- TCCAGTATGTGAGCCCCTTG -3'
(R):5'- CATTTTGGTTGAACAAAGGGAAGAC -3'

Sequencing Primer
(F):5'- TATGTGAGCCCCTTGAGCCC -3'
(R):5'- AGACGGGCTCTAAAGGGC -3'

Posted On

2018-10-18