Incidental Mutation 'R6875:C130060K24Rik'
ID 536368
Institutional Source Beutler Lab
Gene Symbol C130060K24Rik
Ensembl Gene ENSMUSG00000029917
Gene Name RIKEN cDNA C130060K24 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock # R6875 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 65381105-65458150 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 65456336 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 380 (N380I)
Ref Sequence ENSEMBL: ENSMUSP00000130225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000133352] [ENSMUST00000170608]
AlphaFold G3UWA8
Predicted Effect probably benign
Transcript: ENSMUST00000133352
SMART Domains Protein: ENSMUSP00000122416
Gene: ENSMUSG00000029917

DomainStartEndE-ValueType
low complexity region 39 49 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 55 113 1.2e-7 PFAM
Pfam:7tm_1 61 122 1.3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136016
SMART Domains Protein: ENSMUSP00000121875
Gene: ENSMUSG00000029917

DomainStartEndE-ValueType
transmembrane domain 45 67 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170608
AA Change: N380I

PolyPhen 2 Score 0.214 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000130225
Gene: ENSMUSG00000029917
AA Change: N380I

DomainStartEndE-ValueType
low complexity region 39 49 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 55 346 2.5e-5 PFAM
Pfam:7tm_1 61 331 7.2e-56 PFAM
Meta Mutation Damage Score 0.0811 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030458C11Rik T C 15: 12,812,068 H270R probably damaging Het
Abcb1a T C 5: 8,701,628 I336T probably benign Het
Adam19 T A 11: 46,112,875 F177I probably benign Het
Ankrd53 T C 6: 83,768,173 V455A probably damaging Het
Arrdc1 A G 2: 24,925,665 S415P probably benign Het
Atp10a T C 7: 58,797,352 L614P probably benign Het
Catsper1 G T 19: 5,343,963 V668F probably damaging Het
Cluh T A 11: 74,661,918 D596E probably damaging Het
Cnot10 A G 9: 114,615,107 S407P probably benign Het
Commd6 T C 14: 101,634,350 T86A probably damaging Het
D5Ertd579e A T 5: 36,604,657 probably null Het
Eif3l A G 15: 79,085,560 D252G probably damaging Het
Epha2 A T 4: 141,328,468 S962C probably damaging Het
Fcho1 C A 8: 71,714,425 probably null Het
Fgf23 G T 6: 127,073,216 G63C probably damaging Het
Flnc A T 6: 29,445,749 Y834F probably damaging Het
Gcn1l1 T C 5: 115,588,110 L608P probably damaging Het
Hdac5 T A 11: 102,202,276 E545V probably damaging Het
Hecw2 A T 1: 53,937,132 M166K probably benign Het
Ikbkb T C 8: 22,665,893 D586G probably damaging Het
Il1f9 G C 2: 24,188,621 probably null Het
Ipo13 A T 4: 117,904,911 I422N possibly damaging Het
Iqgap3 GGAGAG GGAG 3: 88,112,771 probably null Het
Kat6a G A 8: 22,932,361 A896T probably benign Het
Kif28 A G 1: 179,735,994 I139T probably damaging Het
Klhl25 A G 7: 75,866,342 E332G probably damaging Het
Krt8 C T 15: 101,997,908 A389T probably benign Het
Msrb3 T C 10: 120,784,106 S175G probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo10 T C 15: 25,805,659 Y1709H probably benign Het
Nckap5 A G 1: 126,023,194 S1519P probably benign Het
Npnt T A 3: 132,909,910 D124V probably damaging Het
Nr1d1 A T 11: 98,770,836 probably null Het
Ogdh A G 11: 6,340,477 Y365C probably benign Het
Olfr1305 A T 2: 111,872,961 I298N possibly damaging Het
Phf21b A T 15: 84,787,446 C416S probably damaging Het
Prpsap1 A G 11: 116,471,438 S373P probably damaging Het
Rab28 T C 5: 41,703,534 T26A probably damaging Het
Rbbp8nl A G 2: 180,279,226 I455T probably benign Het
Rnft2 G A 5: 118,228,818 A285V possibly damaging Het
Rrp36 G T 17: 46,672,371 Q106K probably benign Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn5a A G 9: 119,486,644 L1666P probably damaging Het
Siglecf A C 7: 43,355,200 T318P probably benign Het
Slc22a1 C T 17: 12,667,305 W147* probably null Het
Smchd1 T C 17: 71,353,506 I1868V probably damaging Het
Snx21 A G 2: 164,791,902 S203G probably damaging Het
Srl T C 16: 4,482,831 K792R probably benign Het
Srrt A G 5: 137,298,673 F100S probably benign Het
Stard9 G T 2: 120,697,436 M1391I probably benign Het
Syne2 A G 12: 76,035,630 E119G probably damaging Het
Syt11 G T 3: 88,762,155 S143R possibly damaging Het
Tiparp T A 3: 65,531,642 H126Q probably benign Het
Tulp2 C A 7: 45,518,614 T150K probably benign Het
Ugt2b37 T A 5: 87,242,429 Y386F probably benign Het
Usp31 C T 7: 121,649,640 W860* probably null Het
Zfp317 A G 9: 19,643,665 R30G probably damaging Het
Zfp709 C A 8: 71,889,007 N93K possibly damaging Het
Other mutations in C130060K24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02084:C130060K24Rik APN 6 65381610 missense probably benign 0.36
IGL03335:C130060K24Rik APN 6 65453117 critical splice donor site probably null
R1291:C130060K24Rik UTSW 6 65452900 nonsense probably null
R1689:C130060K24Rik UTSW 6 65381607 missense possibly damaging 0.84
R1705:C130060K24Rik UTSW 6 65456306 missense probably benign 0.01
R2188:C130060K24Rik UTSW 6 65441276 missense probably damaging 0.97
R3955:C130060K24Rik UTSW 6 65453108 missense possibly damaging 0.73
R4058:C130060K24Rik UTSW 6 65381541 missense probably damaging 1.00
R4572:C130060K24Rik UTSW 6 65454991 missense probably benign 0.06
R4597:C130060K24Rik UTSW 6 65447424 critical splice donor site probably null
R4756:C130060K24Rik UTSW 6 65452914 missense probably benign 0.02
R5139:C130060K24Rik UTSW 6 65456219 missense probably damaging 0.98
R5872:C130060K24Rik UTSW 6 65441385 intron probably benign
R6193:C130060K24Rik UTSW 6 65456158 missense probably damaging 1.00
R6305:C130060K24Rik UTSW 6 65454991 missense probably benign 0.06
R6423:C130060K24Rik UTSW 6 65456093 missense probably benign 0.01
R6453:C130060K24Rik UTSW 6 65453030 missense possibly damaging 0.71
R6677:C130060K24Rik UTSW 6 65456245 missense probably benign
R6744:C130060K24Rik UTSW 6 65441340 missense possibly damaging 0.88
R6793:C130060K24Rik UTSW 6 65381421 missense probably benign 0.20
R6941:C130060K24Rik UTSW 6 65447401 missense probably damaging 1.00
R6995:C130060K24Rik UTSW 6 65441301 missense probably damaging 1.00
R7063:C130060K24Rik UTSW 6 65441403 intron probably benign
R7564:C130060K24Rik UTSW 6 65452907 nonsense probably null
R7699:C130060K24Rik UTSW 6 65452956 missense probably benign 0.30
R7700:C130060K24Rik UTSW 6 65452956 missense probably benign 0.30
R7711:C130060K24Rik UTSW 6 65441373 missense
R7799:C130060K24Rik UTSW 6 65456137 missense possibly damaging 0.78
R7801:C130060K24Rik UTSW 6 65441217 missense probably damaging 1.00
R8737:C130060K24Rik UTSW 6 65456276 missense probably benign
R8762:C130060K24Rik UTSW 6 65447409 missense probably benign 0.12
R8927:C130060K24Rik UTSW 6 65381613 nonsense probably null
R8928:C130060K24Rik UTSW 6 65381613 nonsense probably null
R9317:C130060K24Rik UTSW 6 65447384 missense probably benign 0.10
R9405:C130060K24Rik UTSW 6 65456094 missense probably benign 0.16
RF018:C130060K24Rik UTSW 6 65456190 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCAGACTCCTTTTAGTCATGAG -3'
(R):5'- CTCATTCTGAAGACATTGGTACAG -3'

Sequencing Primer
(F):5'- GAGAATGTTTCACATCATTTAGCCAC -3'
(R):5'- AGTGTTCACGTCTACAGCAG -3'
Posted On 2018-10-18