Mutagenetix > Incidental Mutation

Incidental Mutation 'R6875:Siglecf'

536371

Institutional Source

Beutler Lab

Gene Symbol

Siglecf

Ensembl Gene

ENSMUSG00000039013

Gene Name

sialic acid binding Ig-like lectin F

Synonyms

mSiglec-F, Siglec5

MMRRC Submission

044971-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6875 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

43351341-43359531 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 43355200 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Proline at position 318 (T318P)

Ref Sequence

ENSEMBL: ENSMUSP00000146009 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000012798] [ENSMUST00000121494] [ENSMUST00000122423] [ENSMUST00000206299]

AlphaFold

Q920G3

Predicted Effect

probably benign
Transcript: ENSMUST00000012798
AA Change: T318P

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000012798
Gene: ENSMUSG00000039013
AA Change: T318P

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
IG	25	131	6.07e-3	SMART
IG_like	142	226	4.91e1	SMART
IGc2	256	315	8.7e-13	SMART
transmembrane domain	440	462	N/A	INTRINSIC
low complexity region	486	500	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000121494
AA Change: T318P

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000112583
Gene: ENSMUSG00000039013
AA Change: T318P

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
IG	25	131	6.07e-3	SMART
IG_like	142	226	4.91e1	SMART
IGc2	256	315	8.7e-13	SMART
Pfam:Ig_2	329	421	2.4e-3	PFAM
transmembrane domain	440	462	N/A	INTRINSIC
low complexity region	486	500	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000122423
AA Change: T318P

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000113245
Gene: ENSMUSG00000039013
AA Change: T318P

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
IG	25	131	6.07e-3	SMART
IG_like	142	226	4.91e1	SMART
IGc2	256	315	8.7e-13	SMART
Pfam:Ig_2	329	421	5.1e-4	PFAM
transmembrane domain	440	462	N/A	INTRINSIC
low complexity region	486	500	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000206299
AA Change: T318P

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.2%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sialic acid-binding immunoglobulin (Ig)-like lectins, or SIGLECs (e.g., CD33 (MIM 159590)), are a family of type 1 transmembrane proteins each having a unique expression pattern, mostly in hemopoietic cells. SIGLEC8 is a member of the CD33-like subgroup of SIGLECs, which are localized to 19q13.3-q13.4 and have 2 conserved cytoplasmic tyrosine-based motifs: an immunoreceptor tyrosine-based inhibitory motif, or ITIM (see MIM 604964), and a motif homologous to one identified in signaling lymphocyte activation molecule (SLAM; MIM 603492) that mediates an association with SLAM-associated protein (SAP; MIM 300490) (summarized by Foussias et al., 2000 [PubMed 11095983]).[supplied by OMIM, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased lung inflammation in response to ovalbumin challenge with increased eosinophils, delayed eosinophil resolution and impaired eosinophil apoptosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6030458C11Rik	T	C	15: 12,812,068	H270R	probably damaging	Het
Abcb1a	T	C	5: 8,701,628	I336T	probably benign	Het
Adam19	T	A	11: 46,112,875	F177I	probably benign	Het
Ankrd53	T	C	6: 83,768,173	V455A	probably damaging	Het
Arrdc1	A	G	2: 24,925,665	S415P	probably benign	Het
Atp10a	T	C	7: 58,797,352	L614P	probably benign	Het
C130060K24Rik	A	T	6: 65,456,336	N380I	probably benign	Het
Catsper1	G	T	19: 5,343,963	V668F	probably damaging	Het
Cluh	T	A	11: 74,661,918	D596E	probably damaging	Het
Cnot10	A	G	9: 114,615,107	S407P	probably benign	Het
Commd6	T	C	14: 101,634,350	T86A	probably damaging	Het
D5Ertd579e	A	T	5: 36,604,657		probably null	Het
Eif3l	A	G	15: 79,085,560	D252G	probably damaging	Het
Epha2	A	T	4: 141,328,468	S962C	probably damaging	Het
Fcho1	C	A	8: 71,714,425		probably null	Het
Fgf23	G	T	6: 127,073,216	G63C	probably damaging	Het
Flnc	A	T	6: 29,445,749	Y834F	probably damaging	Het
Gcn1l1	T	C	5: 115,588,110	L608P	probably damaging	Het
Hdac5	T	A	11: 102,202,276	E545V	probably damaging	Het
Hecw2	A	T	1: 53,937,132	M166K	probably benign	Het
Ikbkb	T	C	8: 22,665,893	D586G	probably damaging	Het
Il1f9	G	C	2: 24,188,621		probably null	Het
Ipo13	A	T	4: 117,904,911	I422N	possibly damaging	Het
Iqgap3	GGAGAG	GGAG	3: 88,112,771		probably null	Het
Kat6a	G	A	8: 22,932,361	A896T	probably benign	Het
Kif28	A	G	1: 179,735,994	I139T	probably damaging	Het
Klhl25	A	G	7: 75,866,342	E332G	probably damaging	Het
Krt8	C	T	15: 101,997,908	A389T	probably benign	Het
Msrb3	T	C	10: 120,784,106	S175G	probably benign	Het
Muc5ac	C	T	7: 141,809,744		probably benign	Het
Myo10	T	C	15: 25,805,659	Y1709H	probably benign	Het
Nckap5	A	G	1: 126,023,194	S1519P	probably benign	Het
Npnt	T	A	3: 132,909,910	D124V	probably damaging	Het
Nr1d1	A	T	11: 98,770,836		probably null	Het
Ogdh	A	G	11: 6,340,477	Y365C	probably benign	Het
Olfr1305	A	T	2: 111,872,961	I298N	possibly damaging	Het
Phf21b	A	T	15: 84,787,446	C416S	probably damaging	Het
Prpsap1	A	G	11: 116,471,438	S373P	probably damaging	Het
Rab28	T	C	5: 41,703,534	T26A	probably damaging	Het
Rbbp8nl	A	G	2: 180,279,226	I455T	probably benign	Het
Rnft2	G	A	5: 118,228,818	A285V	possibly damaging	Het
Rrp36	G	T	17: 46,672,371	Q106K	probably benign	Het
Rsf1	CG	CGACGGCGGAG	7: 97,579,908		probably benign	Het
Runx2	G	A	17: 44,814,192	P80L	probably damaging	Het
Scn5a	A	G	9: 119,486,644	L1666P	probably damaging	Het
Slc22a1	C	T	17: 12,667,305	W147*	probably null	Het
Smchd1	T	C	17: 71,353,506	I1868V	probably damaging	Het
Snx21	A	G	2: 164,791,902	S203G	probably damaging	Het
Srl	T	C	16: 4,482,831	K792R	probably benign	Het
Srrt	A	G	5: 137,298,673	F100S	probably benign	Het
Stard9	G	T	2: 120,697,436	M1391I	probably benign	Het
Syne2	A	G	12: 76,035,630	E119G	probably damaging	Het
Syt11	G	T	3: 88,762,155	S143R	possibly damaging	Het
Tiparp	T	A	3: 65,531,642	H126Q	probably benign	Het
Tulp2	C	A	7: 45,518,614	T150K	probably benign	Het
Ugt2b37	T	A	5: 87,242,429	Y386F	probably benign	Het
Usp31	C	T	7: 121,649,640	W860*	probably null	Het
Zfp317	A	G	9: 19,643,665	R30G	probably damaging	Het
Zfp709	C	A	8: 71,889,007	N93K	possibly damaging	Het

Other mutations in Siglecf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01306:Siglecf	APN	7	43351953	nonsense	probably null
IGL01350:Siglecf	APN	7	43355895	intron	probably benign
IGL01458:Siglecf	APN	7	43355138	missense	possibly damaging	0.46
IGL01582:Siglecf	APN	7	43358721	missense	possibly damaging	0.55
IGL02347:Siglecf	APN	7	43351721	missense	possibly damaging	0.78
IGL02530:Siglecf	APN	7	43352210	missense	probably benign	0.07
IGL02700:Siglecf	APN	7	43352378	missense	probably damaging	1.00
IGL03093:Siglecf	APN	7	43352441	missense	probably damaging	1.00
IGL03178:Siglecf	APN	7	43358739	missense	probably damaging	0.98
IGL03280:Siglecf	APN	7	43355930	missense	probably benign	0.04
ANU23:Siglecf	UTSW	7	43351953	nonsense	probably null
R0003:Siglecf	UTSW	7	43355926	missense	probably benign
R0025:Siglecf	UTSW	7	43351925	missense	probably benign	0.29
R0304:Siglecf	UTSW	7	43352401	missense	probably damaging	1.00
R0345:Siglecf	UTSW	7	43351944	missense	probably damaging	1.00
R0395:Siglecf	UTSW	7	43355975	missense	probably damaging	1.00
R0515:Siglecf	UTSW	7	43355631	critical splice donor site	probably null
R1296:Siglecf	UTSW	7	43355920	nonsense	probably null
R1861:Siglecf	UTSW	7	43352224	missense	probably benign	0.00
R1861:Siglecf	UTSW	7	43355543	missense	probably benign	0.01
R1869:Siglecf	UTSW	7	43355543	missense	probably benign	0.01
R1870:Siglecf	UTSW	7	43355543	missense	probably benign	0.01
R1871:Siglecf	UTSW	7	43355543	missense	probably benign	0.01
R2063:Siglecf	UTSW	7	43352380	missense	possibly damaging	0.79
R2176:Siglecf	UTSW	7	43351716	missense	probably damaging	0.98
R2237:Siglecf	UTSW	7	43354985	missense	probably benign	0.06
R4023:Siglecf	UTSW	7	43355571	missense	possibly damaging	0.56
R4498:Siglecf	UTSW	7	43352276	missense	possibly damaging	0.47
R4664:Siglecf	UTSW	7	43356413	missense	possibly damaging	0.75
R5227:Siglecf	UTSW	7	43351940	missense	probably damaging	1.00
R5315:Siglecf	UTSW	7	43355108	missense	probably benign	0.01
R5763:Siglecf	UTSW	7	43356320	nonsense	probably null
R5828:Siglecf	UTSW	7	43351713	missense	probably damaging	1.00
R5871:Siglecf	UTSW	7	43355621	missense	probably benign	0.04
R5952:Siglecf	UTSW	7	43355927	missense	probably benign	0.00
R6054:Siglecf	UTSW	7	43355006	missense	probably damaging	1.00
R6537:Siglecf	UTSW	7	43355999	missense	probably benign
R6854:Siglecf	UTSW	7	43352180	missense	probably benign	0.00
R7328:Siglecf	UTSW	7	43352267	missense	possibly damaging	0.92
R7329:Siglecf	UTSW	7	43351971	missense	probably damaging	1.00
R7356:Siglecf	UTSW	7	43356431	missense	probably benign	0.00
R7369:Siglecf	UTSW	7	43351817	missense	probably damaging	0.99
R7659:Siglecf	UTSW	7	43351770	missense	probably damaging	1.00
R7984:Siglecf	UTSW	7	43355231	splice site	probably null
R8074:Siglecf	UTSW	7	43351790	missense	possibly damaging	0.93
R8411:Siglecf	UTSW	7	43351944	missense	probably damaging	1.00
R8686:Siglecf	UTSW	7	43355606	missense	probably benign	0.31
R8724:Siglecf	UTSW	7	43355552	missense	probably damaging	1.00
R8962:Siglecf	UTSW	7	43351716	missense	probably damaging	1.00
R9480:Siglecf	UTSW	7	43352242	missense	possibly damaging	0.79
R9572:Siglecf	UTSW	7	43352634	missense	possibly damaging	0.83
R9592:Siglecf	UTSW	7	43352272	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGATCCAAGAGGGTGAGTCC -3'
(R):5'- TTAACCGTGAAGGAGCCATTGC -3'

Sequencing Primer
(F):5'- CCCTGAGCCTGGTCTGTATG -3'
(R):5'- TGCAGTGCAGACCTTGAC -3'

Posted On

2018-10-18