Incidental Mutation 'R6875:Siglecf'
ID536371
Institutional Source Beutler Lab
Gene Symbol Siglecf
Ensembl Gene ENSMUSG00000039013
Gene Namesialic acid binding Ig-like lectin F
SynonymsmSiglec-F, Siglec5
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6875 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location43351341-43359531 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 43355200 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 318 (T318P)
Ref Sequence ENSEMBL: ENSMUSP00000146009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012798] [ENSMUST00000121494] [ENSMUST00000122423] [ENSMUST00000206299]
Predicted Effect probably benign
Transcript: ENSMUST00000012798
AA Change: T318P

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000012798
Gene: ENSMUSG00000039013
AA Change: T318P

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 25 131 6.07e-3 SMART
IG_like 142 226 4.91e1 SMART
IGc2 256 315 8.7e-13 SMART
transmembrane domain 440 462 N/A INTRINSIC
low complexity region 486 500 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121494
AA Change: T318P

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000112583
Gene: ENSMUSG00000039013
AA Change: T318P

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 25 131 6.07e-3 SMART
IG_like 142 226 4.91e1 SMART
IGc2 256 315 8.7e-13 SMART
Pfam:Ig_2 329 421 2.4e-3 PFAM
transmembrane domain 440 462 N/A INTRINSIC
low complexity region 486 500 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122423
AA Change: T318P

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000113245
Gene: ENSMUSG00000039013
AA Change: T318P

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 25 131 6.07e-3 SMART
IG_like 142 226 4.91e1 SMART
IGc2 256 315 8.7e-13 SMART
Pfam:Ig_2 329 421 5.1e-4 PFAM
transmembrane domain 440 462 N/A INTRINSIC
low complexity region 486 500 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206299
AA Change: T318P

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sialic acid-binding immunoglobulin (Ig)-like lectins, or SIGLECs (e.g., CD33 (MIM 159590)), are a family of type 1 transmembrane proteins each having a unique expression pattern, mostly in hemopoietic cells. SIGLEC8 is a member of the CD33-like subgroup of SIGLECs, which are localized to 19q13.3-q13.4 and have 2 conserved cytoplasmic tyrosine-based motifs: an immunoreceptor tyrosine-based inhibitory motif, or ITIM (see MIM 604964), and a motif homologous to one identified in signaling lymphocyte activation molecule (SLAM; MIM 603492) that mediates an association with SLAM-associated protein (SAP; MIM 300490) (summarized by Foussias et al., 2000 [PubMed 11095983]).[supplied by OMIM, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased lung inflammation in response to ovalbumin challenge with increased eosinophils, delayed eosinophil resolution and impaired eosinophil apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030458C11Rik T C 15: 12,812,068 H270R probably damaging Het
Abcb1a T C 5: 8,701,628 I336T probably benign Het
Adam19 T A 11: 46,112,875 F177I probably benign Het
Ankrd53 T C 6: 83,768,173 V455A probably damaging Het
Arrdc1 A G 2: 24,925,665 S415P probably benign Het
Atp10a T C 7: 58,797,352 L614P probably benign Het
C130060K24Rik A T 6: 65,456,336 N380I probably benign Het
Catsper1 G T 19: 5,343,963 V668F probably damaging Het
Cluh T A 11: 74,661,918 D596E probably damaging Het
Cnot10 A G 9: 114,615,107 S407P probably benign Het
Commd6 T C 14: 101,634,350 T86A probably damaging Het
D5Ertd579e A T 5: 36,604,657 probably null Het
Eif3l A G 15: 79,085,560 D252G probably damaging Het
Epha2 A T 4: 141,328,468 S962C probably damaging Het
Fcho1 C A 8: 71,714,425 probably null Het
Fgf23 G T 6: 127,073,216 G63C probably damaging Het
Flnc A T 6: 29,445,749 Y834F probably damaging Het
Gcn1l1 T C 5: 115,588,110 L608P probably damaging Het
Hdac5 T A 11: 102,202,276 E545V probably damaging Het
Hecw2 A T 1: 53,937,132 M166K probably benign Het
Ikbkb T C 8: 22,665,893 D586G probably damaging Het
Il1f9 G C 2: 24,188,621 probably null Het
Ipo13 A T 4: 117,904,911 I422N possibly damaging Het
Iqgap3 GGAGAG GGAG 3: 88,112,771 probably null Het
Kat6a G A 8: 22,932,361 A896T probably benign Het
Kif28 A G 1: 179,735,994 I139T probably damaging Het
Klhl25 A G 7: 75,866,342 E332G probably damaging Het
Krt8 C T 15: 101,997,908 A389T probably benign Het
Msrb3 T C 10: 120,784,106 S175G probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo10 T C 15: 25,805,659 Y1709H probably benign Het
Nckap5 A G 1: 126,023,194 S1519P probably benign Het
Npnt T A 3: 132,909,910 D124V probably damaging Het
Nr1d1 A T 11: 98,770,836 probably null Het
Ogdh A G 11: 6,340,477 Y365C probably benign Het
Olfr1305 A T 2: 111,872,961 I298N possibly damaging Het
Phf21b A T 15: 84,787,446 C416S probably damaging Het
Prpsap1 A G 11: 116,471,438 S373P probably damaging Het
Rab28 T C 5: 41,703,534 T26A probably damaging Het
Rbbp8nl A G 2: 180,279,226 I455T probably benign Het
Rnft2 G A 5: 118,228,818 A285V possibly damaging Het
Rrp36 G T 17: 46,672,371 Q106K probably benign Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn5a A G 9: 119,486,644 L1666P probably damaging Het
Slc22a1 C T 17: 12,667,305 W147* probably null Het
Smchd1 T C 17: 71,353,506 I1868V probably damaging Het
Snx21 A G 2: 164,791,902 S203G probably damaging Het
Srl T C 16: 4,482,831 K792R probably benign Het
Srrt A G 5: 137,298,673 F100S probably benign Het
Stard9 G T 2: 120,697,436 M1391I probably benign Het
Syne2 A G 12: 76,035,630 E119G probably damaging Het
Syt11 G T 3: 88,762,155 S143R possibly damaging Het
Tiparp T A 3: 65,531,642 H126Q probably benign Het
Tulp2 C A 7: 45,518,614 T150K probably benign Het
Ugt2b37 T A 5: 87,242,429 Y386F probably benign Het
Usp31 C T 7: 121,649,640 W860* probably null Het
Zfp317 A G 9: 19,643,665 R30G probably damaging Het
Zfp709 C A 8: 71,889,007 N93K possibly damaging Het
Other mutations in Siglecf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Siglecf APN 7 43351953 nonsense probably null
IGL01350:Siglecf APN 7 43355895 intron probably benign
IGL01458:Siglecf APN 7 43355138 missense possibly damaging 0.46
IGL01582:Siglecf APN 7 43358721 missense possibly damaging 0.55
IGL02347:Siglecf APN 7 43351721 missense possibly damaging 0.78
IGL02530:Siglecf APN 7 43352210 missense probably benign 0.07
IGL02700:Siglecf APN 7 43352378 missense probably damaging 1.00
IGL03093:Siglecf APN 7 43352441 missense probably damaging 1.00
IGL03178:Siglecf APN 7 43358739 missense probably damaging 0.98
IGL03280:Siglecf APN 7 43355930 missense probably benign 0.04
ANU23:Siglecf UTSW 7 43351953 nonsense probably null
R0003:Siglecf UTSW 7 43355926 missense probably benign
R0025:Siglecf UTSW 7 43351925 missense probably benign 0.29
R0304:Siglecf UTSW 7 43352401 missense probably damaging 1.00
R0345:Siglecf UTSW 7 43351944 missense probably damaging 1.00
R0395:Siglecf UTSW 7 43355975 missense probably damaging 1.00
R0515:Siglecf UTSW 7 43355631 critical splice donor site probably null
R1296:Siglecf UTSW 7 43355920 nonsense probably null
R1861:Siglecf UTSW 7 43352224 missense probably benign 0.00
R1861:Siglecf UTSW 7 43355543 missense probably benign 0.01
R1869:Siglecf UTSW 7 43355543 missense probably benign 0.01
R1870:Siglecf UTSW 7 43355543 missense probably benign 0.01
R1871:Siglecf UTSW 7 43355543 missense probably benign 0.01
R2063:Siglecf UTSW 7 43352380 missense possibly damaging 0.79
R2176:Siglecf UTSW 7 43351716 missense probably damaging 0.98
R2237:Siglecf UTSW 7 43354985 missense probably benign 0.06
R4023:Siglecf UTSW 7 43355571 missense possibly damaging 0.56
R4498:Siglecf UTSW 7 43352276 missense possibly damaging 0.47
R4664:Siglecf UTSW 7 43356413 missense possibly damaging 0.75
R5227:Siglecf UTSW 7 43351940 missense probably damaging 1.00
R5315:Siglecf UTSW 7 43355108 missense probably benign 0.01
R5763:Siglecf UTSW 7 43356320 nonsense probably null
R5828:Siglecf UTSW 7 43351713 missense probably damaging 1.00
R5871:Siglecf UTSW 7 43355621 missense probably benign 0.04
R5952:Siglecf UTSW 7 43355927 missense probably benign 0.00
R6054:Siglecf UTSW 7 43355006 missense probably damaging 1.00
R6537:Siglecf UTSW 7 43355999 missense probably benign
R6854:Siglecf UTSW 7 43352180 missense probably benign 0.00
R7328:Siglecf UTSW 7 43352267 missense possibly damaging 0.92
R7329:Siglecf UTSW 7 43351971 missense probably damaging 1.00
R7356:Siglecf UTSW 7 43356431 missense probably benign 0.00
R7369:Siglecf UTSW 7 43351817 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGATCCAAGAGGGTGAGTCC -3'
(R):5'- TTAACCGTGAAGGAGCCATTGC -3'

Sequencing Primer
(F):5'- CCCTGAGCCTGGTCTGTATG -3'
(R):5'- TGCAGTGCAGACCTTGAC -3'
Posted On2018-10-18