Incidental Mutation 'R6875:Tulp2'
ID536372
Institutional Source Beutler Lab
Gene Symbol Tulp2
Ensembl Gene ENSMUSG00000023467
Gene Nametubby-like protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R6875 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location45481877-45523632 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 45518614 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 150 (T150K)
Ref Sequence ENSEMBL: ENSMUSP00000147710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024233] [ENSMUST00000042105] [ENSMUST00000085331] [ENSMUST00000107758] [ENSMUST00000107759] [ENSMUST00000107762] [ENSMUST00000167273] [ENSMUST00000209763] [ENSMUST00000210299] [ENSMUST00000210532] [ENSMUST00000210813] [ENSMUST00000210868] [ENSMUST00000211212]
Predicted Effect probably benign
Transcript: ENSMUST00000024233
AA Change: T262K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000024233
Gene: ENSMUSG00000023467
AA Change: T262K

DomainStartEndE-ValueType
low complexity region 67 77 N/A INTRINSIC
low complexity region 212 220 N/A INTRINSIC
Pfam:Tub 315 556 1.1e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042105
SMART Domains Protein: ENSMUSP00000049488
Gene: ENSMUSG00000040435

DomainStartEndE-ValueType
low complexity region 149 160 N/A INTRINSIC
low complexity region 225 234 N/A INTRINSIC
internal_repeat_1 245 333 1.03e-15 PROSPERO
low complexity region 334 351 N/A INTRINSIC
internal_repeat_1 357 447 1.03e-15 PROSPERO
low complexity region 448 459 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
Pfam:PP1c_bdg 536 612 8.2e-15 PFAM
low complexity region 636 652 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085331
AA Change: T138K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000082438
Gene: ENSMUSG00000023467
AA Change: T138K

DomainStartEndE-ValueType
low complexity region 88 96 N/A INTRINSIC
Pfam:Tub 191 432 6.2e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107758
AA Change: T150K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000103387
Gene: ENSMUSG00000023467
AA Change: T150K

DomainStartEndE-ValueType
low complexity region 100 108 N/A INTRINSIC
Pfam:Tub 203 451 4.1e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107759
AA Change: T150K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000103388
Gene: ENSMUSG00000023467
AA Change: T150K

DomainStartEndE-ValueType
low complexity region 100 108 N/A INTRINSIC
Pfam:Tub 203 444 3.4e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107762
AA Change: T262K

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000103391
Gene: ENSMUSG00000023467
AA Change: T262K

DomainStartEndE-ValueType
Pfam:Tub_N 39 295 8.8e-36 PFAM
Pfam:Tub 315 556 1.3e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167273
SMART Domains Protein: ENSMUSP00000128497
Gene: ENSMUSG00000040435

DomainStartEndE-ValueType
low complexity region 149 160 N/A INTRINSIC
low complexity region 225 234 N/A INTRINSIC
internal_repeat_1 245 333 1.03e-15 PROSPERO
low complexity region 334 351 N/A INTRINSIC
internal_repeat_1 357 447 1.03e-15 PROSPERO
low complexity region 448 459 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
Pfam:PP1c_bdg 531 612 1.1e-20 PFAM
low complexity region 636 652 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209763
Predicted Effect probably benign
Transcript: ENSMUST00000210299
Predicted Effect probably benign
Transcript: ENSMUST00000210532
Predicted Effect probably benign
Transcript: ENSMUST00000210813
AA Change: T150K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000210868
AA Change: T150K

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000211212
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TULP2 is a member of a family of tubby-like genes (TULPs) that encode proteins of unknown function. Members of this family have been identified in plants, vertebrates, and invertebrates. The TULP proteins share a conserved C-terminal region of approximately 200 amino acid residues. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030458C11Rik T C 15: 12,812,068 H270R probably damaging Het
Abcb1a T C 5: 8,701,628 I336T probably benign Het
Adam19 T A 11: 46,112,875 F177I probably benign Het
Ankrd53 T C 6: 83,768,173 V455A probably damaging Het
Arrdc1 A G 2: 24,925,665 S415P probably benign Het
Atp10a T C 7: 58,797,352 L614P probably benign Het
C130060K24Rik A T 6: 65,456,336 N380I probably benign Het
Catsper1 G T 19: 5,343,963 V668F probably damaging Het
Cluh T A 11: 74,661,918 D596E probably damaging Het
Cnot10 A G 9: 114,615,107 S407P probably benign Het
Commd6 T C 14: 101,634,350 T86A probably damaging Het
D5Ertd579e A T 5: 36,604,657 probably null Het
Eif3l A G 15: 79,085,560 D252G probably damaging Het
Epha2 A T 4: 141,328,468 S962C probably damaging Het
Fcho1 C A 8: 71,714,425 probably null Het
Fgf23 G T 6: 127,073,216 G63C probably damaging Het
Flnc A T 6: 29,445,749 Y834F probably damaging Het
Gcn1l1 T C 5: 115,588,110 L608P probably damaging Het
Hdac5 T A 11: 102,202,276 E545V probably damaging Het
Hecw2 A T 1: 53,937,132 M166K probably benign Het
Ikbkb T C 8: 22,665,893 D586G probably damaging Het
Il1f9 G C 2: 24,188,621 probably null Het
Ipo13 A T 4: 117,904,911 I422N possibly damaging Het
Iqgap3 GGAGAG GGAG 3: 88,112,771 probably null Het
Kat6a G A 8: 22,932,361 A896T probably benign Het
Kif28 A G 1: 179,735,994 I139T probably damaging Het
Klhl25 A G 7: 75,866,342 E332G probably damaging Het
Krt8 C T 15: 101,997,908 A389T probably benign Het
Msrb3 T C 10: 120,784,106 S175G probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo10 T C 15: 25,805,659 Y1709H probably benign Het
Nckap5 A G 1: 126,023,194 S1519P probably benign Het
Npnt T A 3: 132,909,910 D124V probably damaging Het
Nr1d1 A T 11: 98,770,836 probably null Het
Ogdh A G 11: 6,340,477 Y365C probably benign Het
Olfr1305 A T 2: 111,872,961 I298N possibly damaging Het
Phf21b A T 15: 84,787,446 C416S probably damaging Het
Prpsap1 A G 11: 116,471,438 S373P probably damaging Het
Rab28 T C 5: 41,703,534 T26A probably damaging Het
Rbbp8nl A G 2: 180,279,226 I455T probably benign Het
Rnft2 G A 5: 118,228,818 A285V possibly damaging Het
Rrp36 G T 17: 46,672,371 Q106K probably benign Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn5a A G 9: 119,486,644 L1666P probably damaging Het
Siglecf A C 7: 43,355,200 T318P probably benign Het
Slc22a1 C T 17: 12,667,305 W147* probably null Het
Smchd1 T C 17: 71,353,506 I1868V probably damaging Het
Snx21 A G 2: 164,791,902 S203G probably damaging Het
Srl T C 16: 4,482,831 K792R probably benign Het
Srrt A G 5: 137,298,673 F100S probably benign Het
Stard9 G T 2: 120,697,436 M1391I probably benign Het
Syne2 A G 12: 76,035,630 E119G probably damaging Het
Syt11 G T 3: 88,762,155 S143R possibly damaging Het
Tiparp T A 3: 65,531,642 H126Q probably benign Het
Ugt2b37 T A 5: 87,242,429 Y386F probably benign Het
Usp31 C T 7: 121,649,640 W860* probably null Het
Zfp317 A G 9: 19,643,665 R30G probably damaging Het
Zfp709 C A 8: 71,889,007 N93K possibly damaging Het
Other mutations in Tulp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Tulp2 APN 7 45521908 missense probably damaging 1.00
IGL00942:Tulp2 APN 7 45516268 missense possibly damaging 0.87
IGL01881:Tulp2 APN 7 45520795 missense probably damaging 1.00
IGL03240:Tulp2 APN 7 45522310 missense probably damaging 1.00
IGL03242:Tulp2 APN 7 45521858 missense probably damaging 0.99
IGL03353:Tulp2 APN 7 45516272 missense probably damaging 1.00
R0063:Tulp2 UTSW 7 45520860 unclassified probably benign
R0063:Tulp2 UTSW 7 45520860 unclassified probably benign
R0306:Tulp2 UTSW 7 45518576 unclassified probably benign
R0648:Tulp2 UTSW 7 45519786 missense probably damaging 1.00
R0710:Tulp2 UTSW 7 45520808 missense possibly damaging 0.92
R1168:Tulp2 UTSW 7 45517842 missense probably benign
R1345:Tulp2 UTSW 7 45518721 missense probably benign 0.13
R1737:Tulp2 UTSW 7 45519777 missense probably damaging 1.00
R1854:Tulp2 UTSW 7 45517943 missense probably damaging 0.98
R1918:Tulp2 UTSW 7 45517941 missense possibly damaging 0.95
R2356:Tulp2 UTSW 7 45518628 missense possibly damaging 0.85
R3012:Tulp2 UTSW 7 45518763 missense probably damaging 1.00
R3419:Tulp2 UTSW 7 45518752 missense possibly damaging 0.56
R4236:Tulp2 UTSW 7 45521874 missense probably damaging 1.00
R4701:Tulp2 UTSW 7 45517924 missense probably damaging 0.98
R5367:Tulp2 UTSW 7 45516651 missense possibly damaging 0.95
R6056:Tulp2 UTSW 7 45490373 splice site probably null
R6294:Tulp2 UTSW 7 45514692 missense probably damaging 1.00
R6432:Tulp2 UTSW 7 45518588 missense probably benign 0.01
R7459:Tulp2 UTSW 7 45519803 missense probably damaging 1.00
R7556:Tulp2 UTSW 7 45518581 splice site probably null
R7676:Tulp2 UTSW 7 45521027 missense possibly damaging 0.86
R7883:Tulp2 UTSW 7 45516764 splice site probably null
R8775:Tulp2 UTSW 7 45515490 missense probably benign
R8775-TAIL:Tulp2 UTSW 7 45515490 missense probably benign
R8804:Tulp2 UTSW 7 45520974 missense probably damaging 1.00
Z1088:Tulp2 UTSW 7 45521986 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCAACAGATGTGCCAACTG -3'
(R):5'- ATGCCGTGCTTGTTTCGGAC -3'

Sequencing Primer
(F):5'- ATGTGCCAACTGGATCAGGC -3'
(R):5'- TTTCGGACGATGCGGCAC -3'
Posted On2018-10-18