Mutagenetix > Incidental Mutation

Incidental Mutation 'R6875:Atp10a'

536373

Institutional Source

Beutler Lab

Gene Symbol

Atp10a

Ensembl Gene

ENSMUSG00000025324

Gene Name

ATPase, class V, type 10A

Synonyms

Atp10c, pfatp

MMRRC Submission

044971-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.103) question?

Stock #

R6875 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

58656166-58829420 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 58797352 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 614 (L614P)

Ref Sequence

ENSEMBL: ENSMUSP00000129811 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168747]

AlphaFold

O54827

Predicted Effect

probably benign
Transcript: ENSMUST00000168747
AA Change: L614P

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000129811
Gene: ENSMUSG00000025324
AA Change: L614P

Domain	Start	End	E-Value	Type
low complexity region	15	32	N/A	INTRINSIC
Pfam:PhoLip_ATPase_N	55	114	5.2e-23	PFAM
Pfam:E1-E2_ATPase	120	393	6.6e-10	PFAM
low complexity region	633	643	N/A	INTRINSIC
Pfam:Cation_ATPase	685	791	1.5e-7	PFAM
Pfam:HAD	697	1054	2.1e-12	PFAM
Pfam:PhoLip_ATPase_C	1071	1316	1.1e-76	PFAM
low complexity region	1458	1477	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.2%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. This gene is maternally expressed. It maps within the most common interval of deletion responsible for Angelman syndrome, also known as 'happy puppet syndrome'. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this gene at the distal end of the p^23DFiOD deletion may be responsible for the obesity phenotypes associated with that deletion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6030458C11Rik	T	C	15: 12,812,068	H270R	probably damaging	Het
Abcb1a	T	C	5: 8,701,628	I336T	probably benign	Het
Adam19	T	A	11: 46,112,875	F177I	probably benign	Het
Ankrd53	T	C	6: 83,768,173	V455A	probably damaging	Het
Arrdc1	A	G	2: 24,925,665	S415P	probably benign	Het
C130060K24Rik	A	T	6: 65,456,336	N380I	probably benign	Het
Catsper1	G	T	19: 5,343,963	V668F	probably damaging	Het
Cluh	T	A	11: 74,661,918	D596E	probably damaging	Het
Cnot10	A	G	9: 114,615,107	S407P	probably benign	Het
Commd6	T	C	14: 101,634,350	T86A	probably damaging	Het
D5Ertd579e	A	T	5: 36,604,657		probably null	Het
Eif3l	A	G	15: 79,085,560	D252G	probably damaging	Het
Epha2	A	T	4: 141,328,468	S962C	probably damaging	Het
Fcho1	C	A	8: 71,714,425		probably null	Het
Fgf23	G	T	6: 127,073,216	G63C	probably damaging	Het
Flnc	A	T	6: 29,445,749	Y834F	probably damaging	Het
Gcn1l1	T	C	5: 115,588,110	L608P	probably damaging	Het
Hdac5	T	A	11: 102,202,276	E545V	probably damaging	Het
Hecw2	A	T	1: 53,937,132	M166K	probably benign	Het
Ikbkb	T	C	8: 22,665,893	D586G	probably damaging	Het
Il1f9	G	C	2: 24,188,621		probably null	Het
Ipo13	A	T	4: 117,904,911	I422N	possibly damaging	Het
Iqgap3	GGAGAG	GGAG	3: 88,112,771		probably null	Het
Kat6a	G	A	8: 22,932,361	A896T	probably benign	Het
Kif28	A	G	1: 179,735,994	I139T	probably damaging	Het
Klhl25	A	G	7: 75,866,342	E332G	probably damaging	Het
Krt8	C	T	15: 101,997,908	A389T	probably benign	Het
Msrb3	T	C	10: 120,784,106	S175G	probably benign	Het
Muc5ac	C	T	7: 141,809,744		probably benign	Het
Myo10	T	C	15: 25,805,659	Y1709H	probably benign	Het
Nckap5	A	G	1: 126,023,194	S1519P	probably benign	Het
Npnt	T	A	3: 132,909,910	D124V	probably damaging	Het
Nr1d1	A	T	11: 98,770,836		probably null	Het
Ogdh	A	G	11: 6,340,477	Y365C	probably benign	Het
Olfr1305	A	T	2: 111,872,961	I298N	possibly damaging	Het
Phf21b	A	T	15: 84,787,446	C416S	probably damaging	Het
Prpsap1	A	G	11: 116,471,438	S373P	probably damaging	Het
Rab28	T	C	5: 41,703,534	T26A	probably damaging	Het
Rbbp8nl	A	G	2: 180,279,226	I455T	probably benign	Het
Rnft2	G	A	5: 118,228,818	A285V	possibly damaging	Het
Rrp36	G	T	17: 46,672,371	Q106K	probably benign	Het
Rsf1	CG	CGACGGCGGAG	7: 97,579,908		probably benign	Het
Runx2	G	A	17: 44,814,192	P80L	probably damaging	Het
Scn5a	A	G	9: 119,486,644	L1666P	probably damaging	Het
Siglecf	A	C	7: 43,355,200	T318P	probably benign	Het
Slc22a1	C	T	17: 12,667,305	W147*	probably null	Het
Smchd1	T	C	17: 71,353,506	I1868V	probably damaging	Het
Snx21	A	G	2: 164,791,902	S203G	probably damaging	Het
Srl	T	C	16: 4,482,831	K792R	probably benign	Het
Srrt	A	G	5: 137,298,673	F100S	probably benign	Het
Stard9	G	T	2: 120,697,436	M1391I	probably benign	Het
Syne2	A	G	12: 76,035,630	E119G	probably damaging	Het
Syt11	G	T	3: 88,762,155	S143R	possibly damaging	Het
Tiparp	T	A	3: 65,531,642	H126Q	probably benign	Het
Tulp2	C	A	7: 45,518,614	T150K	probably benign	Het
Ugt2b37	T	A	5: 87,242,429	Y386F	probably benign	Het
Usp31	C	T	7: 121,649,640	W860*	probably null	Het
Zfp317	A	G	9: 19,643,665	R30G	probably damaging	Het
Zfp709	C	A	8: 71,889,007	N93K	possibly damaging	Het

Other mutations in Atp10a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00649:Atp10a	APN	7	58794482	missense	probably benign	0.06
IGL00973:Atp10a	APN	7	58807470	missense	probably damaging	1.00
IGL00984:Atp10a	APN	7	58658741	missense	probably damaging	1.00
IGL01086:Atp10a	APN	7	58824318	missense	probably damaging	0.96
IGL01296:Atp10a	APN	7	58813625	missense	probably benign	0.02
IGL01731:Atp10a	APN	7	58797562	missense	probably benign	0.16
IGL02081:Atp10a	APN	7	58827856	missense	possibly damaging	0.62
IGL02095:Atp10a	APN	7	58807393	missense	probably damaging	1.00
IGL02549:Atp10a	APN	7	58819733	missense	probably benign	0.00
IGL02558:Atp10a	APN	7	58819642	missense	probably damaging	0.98
IGL02659:Atp10a	APN	7	58813631	missense	probably benign
IGL02986:Atp10a	APN	7	58828721	missense	probably benign
IGL03218:Atp10a	APN	7	58788448	critical splice donor site	probably null
PIT4260001:Atp10a	UTSW	7	58791118	nonsense	probably null
PIT4445001:Atp10a	UTSW	7	58803467	missense	probably damaging	0.98
PIT4810001:Atp10a	UTSW	7	58813848	missense	probably damaging	0.99
R0091:Atp10a	UTSW	7	58774046	splice site	probably benign
R0349:Atp10a	UTSW	7	58803467	missense	probably damaging	0.98
R0426:Atp10a	UTSW	7	58784734	missense	probably benign	0.00
R0609:Atp10a	UTSW	7	58819740	splice site	probably null
R0722:Atp10a	UTSW	7	58816183	missense	possibly damaging	0.75
R0741:Atp10a	UTSW	7	58828589	missense	possibly damaging	0.90
R1172:Atp10a	UTSW	7	58803766	missense	probably benign	0.05
R1342:Atp10a	UTSW	7	58816146	splice site	probably benign
R1648:Atp10a	UTSW	7	58784827	missense	probably damaging	1.00
R1715:Atp10a	UTSW	7	58786505	missense	probably damaging	0.98
R1737:Atp10a	UTSW	7	58827238	splice site	probably benign
R1799:Atp10a	UTSW	7	58824434	missense	probably damaging	1.00
R1909:Atp10a	UTSW	7	58828712	missense	probably benign	0.12
R1918:Atp10a	UTSW	7	58827935	missense	possibly damaging	0.82
R2031:Atp10a	UTSW	7	58827930	nonsense	probably null
R2080:Atp10a	UTSW	7	58824327	missense	probably damaging	0.97
R2424:Atp10a	UTSW	7	58794555	missense	probably benign	0.16
R2696:Atp10a	UTSW	7	58813618	missense	probably benign	0.00
R3932:Atp10a	UTSW	7	58827104	missense	possibly damaging	0.69
R4198:Atp10a	UTSW	7	58813686	missense	probably damaging	1.00
R4453:Atp10a	UTSW	7	58658500	small deletion	probably benign
R4632:Atp10a	UTSW	7	58807438	missense	possibly damaging	0.48
R4661:Atp10a	UTSW	7	58658500	small deletion	probably benign
R4782:Atp10a	UTSW	7	58791095	missense	probably benign
R4888:Atp10a	UTSW	7	58785307	missense	probably damaging	1.00
R4935:Atp10a	UTSW	7	58813764	missense	probably damaging	1.00
R5051:Atp10a	UTSW	7	58740246	frame shift	probably null
R5213:Atp10a	UTSW	7	58773983	missense	probably damaging	0.99
R5617:Atp10a	UTSW	7	58803675	missense	probably benign	0.06
R5834:Atp10a	UTSW	7	58658618	missense	probably benign	0.01
R5885:Atp10a	UTSW	7	58813800	missense	possibly damaging	0.92
R6013:Atp10a	UTSW	7	58797790	missense	probably benign	0.05
R6136:Atp10a	UTSW	7	58828340	missense	probably benign
R6269:Atp10a	UTSW	7	58803739	missense	possibly damaging	0.51
R6380:Atp10a	UTSW	7	58819684	nonsense	probably null
R6743:Atp10a	UTSW	7	58797814	missense	possibly damaging	0.89
R6975:Atp10a	UTSW	7	58773985	missense	probably damaging	1.00
R7082:Atp10a	UTSW	7	58658819	missense	probably damaging	1.00
R7203:Atp10a	UTSW	7	58786473	missense	probably benign
R7224:Atp10a	UTSW	7	58797471	missense	probably benign	0.00
R7287:Atp10a	UTSW	7	58827269	missense	probably damaging	1.00
R7437:Atp10a	UTSW	7	58658540	missense	unknown
R7474:Atp10a	UTSW	7	58658527	missense	unknown
R7530:Atp10a	UTSW	7	58773976	missense	probably benign	0.02
R7561:Atp10a	UTSW	7	58827133	missense	probably damaging	0.98
R7743:Atp10a	UTSW	7	58803709	missense	probably damaging	1.00
R7767:Atp10a	UTSW	7	58658849	missense	probably damaging	1.00
R7861:Atp10a	UTSW	7	58788359	missense	probably damaging	1.00
R7903:Atp10a	UTSW	7	58658822	missense	probably damaging	1.00
R8015:Atp10a	UTSW	7	58803497	missense	probably benign	0.00
R8166:Atp10a	UTSW	7	58807522	missense	possibly damaging	0.46
R8201:Atp10a	UTSW	7	58819676	nonsense	probably null
R8465:Atp10a	UTSW	7	58828310	missense	probably benign	0.32
R8858:Atp10a	UTSW	7	58816223	missense	probably damaging	1.00
R8985:Atp10a	UTSW	7	58788344	missense	probably benign	0.03
R9003:Atp10a	UTSW	7	58807455	missense	probably damaging	1.00
R9274:Atp10a	UTSW	7	58828621	missense	probably benign	0.22
R9385:Atp10a	UTSW	7	58828139	missense	probably benign	0.00
R9432:Atp10a	UTSW	7	58819670	missense	possibly damaging	0.95
R9454:Atp10a	UTSW	7	58658591	missense	probably benign
R9596:Atp10a	UTSW	7	58827805	missense	probably damaging	1.00
R9736:Atp10a	UTSW	7	58824330	missense	probably damaging	1.00
Z1176:Atp10a	UTSW	7	58788447	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- AAGAGACAGGCTCAGTTTGTC -3'
(R):5'- TGTAGTACACTCTGAGGCCCAG -3'

Sequencing Primer
(F):5'- AGACAGGCTCAGTTTGTCCTGAAC -3'
(R):5'- ACACTCTGAGGCCCAGCTTTC -3'

Posted On

2018-10-18