Incidental Mutation 'R6875:Klhl25'
ID 536374
Institutional Source Beutler Lab
Gene Symbol Klhl25
Ensembl Gene ENSMUSG00000055652
Gene Name kelch-like 25
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock # R6875 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 75848310-75874131 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 75866342 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 332 (E332G)
Ref Sequence ENSEMBL: ENSMUSP00000146102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092073] [ENSMUST00000171155] [ENSMUST00000205612] [ENSMUST00000205887] [ENSMUST00000206019]
AlphaFold Q8R2P1
Predicted Effect probably damaging
Transcript: ENSMUST00000092073
AA Change: E332G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000089707
Gene: ENSMUSG00000055652
AA Change: E332G

DomainStartEndE-ValueType
BTB 46 144 2.43e-28 SMART
BACK 149 251 1.06e-32 SMART
Blast:BTB 256 294 1e-9 BLAST
Kelch 296 340 1.4e0 SMART
Kelch 341 388 6.71e-10 SMART
Kelch 389 444 2.25e-11 SMART
Kelch 445 492 1.22e-1 SMART
Kelch 493 538 1.92e-5 SMART
Kelch 539 585 1.4e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171155
AA Change: E332G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133175
Gene: ENSMUSG00000055652
AA Change: E332G

DomainStartEndE-ValueType
BTB 46 144 2.43e-28 SMART
BACK 149 251 1.06e-32 SMART
Blast:BTB 256 294 1e-9 BLAST
Kelch 296 340 1.4e0 SMART
Kelch 341 388 6.71e-10 SMART
Kelch 389 444 2.25e-11 SMART
Kelch 445 492 1.22e-1 SMART
Kelch 493 538 1.92e-5 SMART
Kelch 539 585 1.4e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000205612
AA Change: E27G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000205887
Predicted Effect probably damaging
Transcript: ENSMUST00000206019
AA Change: E332G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030458C11Rik T C 15: 12,812,068 H270R probably damaging Het
Abcb1a T C 5: 8,701,628 I336T probably benign Het
Adam19 T A 11: 46,112,875 F177I probably benign Het
Ankrd53 T C 6: 83,768,173 V455A probably damaging Het
Arrdc1 A G 2: 24,925,665 S415P probably benign Het
Atp10a T C 7: 58,797,352 L614P probably benign Het
C130060K24Rik A T 6: 65,456,336 N380I probably benign Het
Catsper1 G T 19: 5,343,963 V668F probably damaging Het
Cluh T A 11: 74,661,918 D596E probably damaging Het
Cnot10 A G 9: 114,615,107 S407P probably benign Het
Commd6 T C 14: 101,634,350 T86A probably damaging Het
D5Ertd579e A T 5: 36,604,657 probably null Het
Eif3l A G 15: 79,085,560 D252G probably damaging Het
Epha2 A T 4: 141,328,468 S962C probably damaging Het
Fcho1 C A 8: 71,714,425 probably null Het
Fgf23 G T 6: 127,073,216 G63C probably damaging Het
Flnc A T 6: 29,445,749 Y834F probably damaging Het
Gcn1l1 T C 5: 115,588,110 L608P probably damaging Het
Hdac5 T A 11: 102,202,276 E545V probably damaging Het
Hecw2 A T 1: 53,937,132 M166K probably benign Het
Ikbkb T C 8: 22,665,893 D586G probably damaging Het
Il1f9 G C 2: 24,188,621 probably null Het
Ipo13 A T 4: 117,904,911 I422N possibly damaging Het
Iqgap3 GGAGAG GGAG 3: 88,112,771 probably null Het
Kat6a G A 8: 22,932,361 A896T probably benign Het
Kif28 A G 1: 179,735,994 I139T probably damaging Het
Krt8 C T 15: 101,997,908 A389T probably benign Het
Msrb3 T C 10: 120,784,106 S175G probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo10 T C 15: 25,805,659 Y1709H probably benign Het
Nckap5 A G 1: 126,023,194 S1519P probably benign Het
Npnt T A 3: 132,909,910 D124V probably damaging Het
Nr1d1 A T 11: 98,770,836 probably null Het
Ogdh A G 11: 6,340,477 Y365C probably benign Het
Olfr1305 A T 2: 111,872,961 I298N possibly damaging Het
Phf21b A T 15: 84,787,446 C416S probably damaging Het
Prpsap1 A G 11: 116,471,438 S373P probably damaging Het
Rab28 T C 5: 41,703,534 T26A probably damaging Het
Rbbp8nl A G 2: 180,279,226 I455T probably benign Het
Rnft2 G A 5: 118,228,818 A285V possibly damaging Het
Rrp36 G T 17: 46,672,371 Q106K probably benign Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn5a A G 9: 119,486,644 L1666P probably damaging Het
Siglecf A C 7: 43,355,200 T318P probably benign Het
Slc22a1 C T 17: 12,667,305 W147* probably null Het
Smchd1 T C 17: 71,353,506 I1868V probably damaging Het
Snx21 A G 2: 164,791,902 S203G probably damaging Het
Srl T C 16: 4,482,831 K792R probably benign Het
Srrt A G 5: 137,298,673 F100S probably benign Het
Stard9 G T 2: 120,697,436 M1391I probably benign Het
Syne2 A G 12: 76,035,630 E119G probably damaging Het
Syt11 G T 3: 88,762,155 S143R possibly damaging Het
Tiparp T A 3: 65,531,642 H126Q probably benign Het
Tulp2 C A 7: 45,518,614 T150K probably benign Het
Ugt2b37 T A 5: 87,242,429 Y386F probably benign Het
Usp31 C T 7: 121,649,640 W860* probably null Het
Zfp317 A G 9: 19,643,665 R30G probably damaging Het
Zfp709 C A 8: 71,889,007 N93K possibly damaging Het
Other mutations in Klhl25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Klhl25 APN 7 75866149 nonsense probably null
IGL01142:Klhl25 APN 7 75866596 missense probably damaging 1.00
IGL01295:Klhl25 APN 7 75865872 missense probably benign 0.20
IGL02272:Klhl25 APN 7 75866620 missense probably benign
IGL02721:Klhl25 APN 7 75866900 missense probably damaging 1.00
R0196:Klhl25 UTSW 7 75865702 missense probably damaging 1.00
R0365:Klhl25 UTSW 7 75866516 missense probably damaging 1.00
R0828:Klhl25 UTSW 7 75866195 missense probably damaging 0.99
R0881:Klhl25 UTSW 7 75866279 missense probably damaging 1.00
R1061:Klhl25 UTSW 7 75866520 nonsense probably null
R1228:Klhl25 UTSW 7 75866120 missense probably benign
R1696:Klhl25 UTSW 7 75866843 missense probably damaging 1.00
R1991:Klhl25 UTSW 7 75866732 missense probably damaging 1.00
R2118:Klhl25 UTSW 7 75866732 missense probably damaging 1.00
R4359:Klhl25 UTSW 7 75866732 missense probably damaging 1.00
R4428:Klhl25 UTSW 7 75865414 missense probably damaging 0.97
R4431:Klhl25 UTSW 7 75865414 missense probably damaging 0.97
R4717:Klhl25 UTSW 7 75866780 missense probably damaging 1.00
R4860:Klhl25 UTSW 7 75867050 missense probably benign 0.03
R4860:Klhl25 UTSW 7 75867050 missense probably benign 0.03
R5619:Klhl25 UTSW 7 75866854 missense probably benign 0.22
R5637:Klhl25 UTSW 7 75865792 splice site probably null
R5652:Klhl25 UTSW 7 75866147 missense probably benign 0.06
R5840:Klhl25 UTSW 7 75866692 missense possibly damaging 0.92
R6693:Klhl25 UTSW 7 75866813 missense possibly damaging 0.91
R6723:Klhl25 UTSW 7 75865991 missense possibly damaging 0.64
R7239:Klhl25 UTSW 7 75866768 missense probably benign 0.25
R8535:Klhl25 UTSW 7 75866095 missense probably benign
R8712:Klhl25 UTSW 7 75865672 missense probably damaging 0.99
R8768:Klhl25 UTSW 7 75866611 missense probably damaging 1.00
R8827:Klhl25 UTSW 7 75866643 missense possibly damaging 0.70
R9033:Klhl25 UTSW 7 75866933 missense probably damaging 0.98
R9046:Klhl25 UTSW 7 75865589 missense probably damaging 1.00
R9404:Klhl25 UTSW 7 75865405 missense probably benign 0.01
R9480:Klhl25 UTSW 7 75866372 missense probably damaging 0.99
Z1177:Klhl25 UTSW 7 75866122 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ATCTTAGACGAGGCCTTCCG -3'
(R):5'- TACCTGCTAGGGATGTATGCC -3'

Sequencing Primer
(F):5'- GCTGCAAGACCAAGATCTTGCTG -3'
(R):5'- CCCACCACATAGAGACAGTTC -3'
Posted On 2018-10-18