Incidental Mutation 'R6875:Usp31'
ID 536376
Institutional Source Beutler Lab
Gene Symbol Usp31
Ensembl Gene ENSMUSG00000063317
Gene Name ubiquitin specific peptidase 31
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock # R6875 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 121642021-121707253 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 121649640 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Stop codon at position 860 (W860*)
Ref Sequence ENSEMBL: ENSMUSP00000040037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046929]
AlphaFold E9Q6Y8
Predicted Effect probably null
Transcript: ENSMUST00000046929
AA Change: W860*
SMART Domains Protein: ENSMUSP00000040037
Gene: ENSMUSG00000063317
AA Change: W860*

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
low complexity region 29 58 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 90 120 N/A INTRINSIC
Pfam:UCH 122 755 2.5e-64 PFAM
Pfam:UCH_1 562 737 1.3e-12 PFAM
low complexity region 763 777 N/A INTRINSIC
low complexity region 792 811 N/A INTRINSIC
low complexity region 831 847 N/A INTRINSIC
low complexity region 869 881 N/A INTRINSIC
low complexity region 985 996 N/A INTRINSIC
low complexity region 1009 1030 N/A INTRINSIC
low complexity region 1044 1060 N/A INTRINSIC
low complexity region 1072 1127 N/A INTRINSIC
low complexity region 1161 1173 N/A INTRINSIC
low complexity region 1192 1204 N/A INTRINSIC
low complexity region 1245 1258 N/A INTRINSIC
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030458C11Rik T C 15: 12,812,068 H270R probably damaging Het
Abcb1a T C 5: 8,701,628 I336T probably benign Het
Adam19 T A 11: 46,112,875 F177I probably benign Het
Ankrd53 T C 6: 83,768,173 V455A probably damaging Het
Arrdc1 A G 2: 24,925,665 S415P probably benign Het
Atp10a T C 7: 58,797,352 L614P probably benign Het
C130060K24Rik A T 6: 65,456,336 N380I probably benign Het
Catsper1 G T 19: 5,343,963 V668F probably damaging Het
Cluh T A 11: 74,661,918 D596E probably damaging Het
Cnot10 A G 9: 114,615,107 S407P probably benign Het
Commd6 T C 14: 101,634,350 T86A probably damaging Het
D5Ertd579e A T 5: 36,604,657 probably null Het
Eif3l A G 15: 79,085,560 D252G probably damaging Het
Epha2 A T 4: 141,328,468 S962C probably damaging Het
Fcho1 C A 8: 71,714,425 probably null Het
Fgf23 G T 6: 127,073,216 G63C probably damaging Het
Flnc A T 6: 29,445,749 Y834F probably damaging Het
Gcn1l1 T C 5: 115,588,110 L608P probably damaging Het
Hdac5 T A 11: 102,202,276 E545V probably damaging Het
Hecw2 A T 1: 53,937,132 M166K probably benign Het
Ikbkb T C 8: 22,665,893 D586G probably damaging Het
Il1f9 G C 2: 24,188,621 probably null Het
Ipo13 A T 4: 117,904,911 I422N possibly damaging Het
Iqgap3 GGAGAG GGAG 3: 88,112,771 probably null Het
Kat6a G A 8: 22,932,361 A896T probably benign Het
Kif28 A G 1: 179,735,994 I139T probably damaging Het
Klhl25 A G 7: 75,866,342 E332G probably damaging Het
Krt8 C T 15: 101,997,908 A389T probably benign Het
Msrb3 T C 10: 120,784,106 S175G probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo10 T C 15: 25,805,659 Y1709H probably benign Het
Nckap5 A G 1: 126,023,194 S1519P probably benign Het
Npnt T A 3: 132,909,910 D124V probably damaging Het
Nr1d1 A T 11: 98,770,836 probably null Het
Ogdh A G 11: 6,340,477 Y365C probably benign Het
Olfr1305 A T 2: 111,872,961 I298N possibly damaging Het
Phf21b A T 15: 84,787,446 C416S probably damaging Het
Prpsap1 A G 11: 116,471,438 S373P probably damaging Het
Rab28 T C 5: 41,703,534 T26A probably damaging Het
Rbbp8nl A G 2: 180,279,226 I455T probably benign Het
Rnft2 G A 5: 118,228,818 A285V possibly damaging Het
Rrp36 G T 17: 46,672,371 Q106K probably benign Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn5a A G 9: 119,486,644 L1666P probably damaging Het
Siglecf A C 7: 43,355,200 T318P probably benign Het
Slc22a1 C T 17: 12,667,305 W147* probably null Het
Smchd1 T C 17: 71,353,506 I1868V probably damaging Het
Snx21 A G 2: 164,791,902 S203G probably damaging Het
Srl T C 16: 4,482,831 K792R probably benign Het
Srrt A G 5: 137,298,673 F100S probably benign Het
Stard9 G T 2: 120,697,436 M1391I probably benign Het
Syne2 A G 12: 76,035,630 E119G probably damaging Het
Syt11 G T 3: 88,762,155 S143R possibly damaging Het
Tiparp T A 3: 65,531,642 H126Q probably benign Het
Tulp2 C A 7: 45,518,614 T150K probably benign Het
Ugt2b37 T A 5: 87,242,429 Y386F probably benign Het
Zfp317 A G 9: 19,643,665 R30G probably damaging Het
Zfp709 C A 8: 71,889,007 N93K possibly damaging Het
Other mutations in Usp31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Usp31 APN 7 121706670 missense probably damaging 1.00
IGL00421:Usp31 APN 7 121648650 missense probably damaging 0.96
IGL00657:Usp31 APN 7 121648231 missense probably benign 0.00
IGL01917:Usp31 APN 7 121679485 missense probably benign 0.26
IGL02444:Usp31 APN 7 121679495 missense probably damaging 1.00
IGL03090:Usp31 APN 7 121679530 splice site probably benign
R0334:Usp31 UTSW 7 121658962 missense probably damaging 0.99
R0945:Usp31 UTSW 7 121670253 missense probably damaging 1.00
R1326:Usp31 UTSW 7 121648302 missense probably damaging 1.00
R2116:Usp31 UTSW 7 121648696 missense probably benign 0.39
R3113:Usp31 UTSW 7 121679513 missense probably damaging 1.00
R4072:Usp31 UTSW 7 121667782 splice site probably null
R4075:Usp31 UTSW 7 121667782 splice site probably null
R4076:Usp31 UTSW 7 121667782 splice site probably null
R4306:Usp31 UTSW 7 121706929 missense possibly damaging 0.93
R4675:Usp31 UTSW 7 121707325 unclassified probably benign
R4960:Usp31 UTSW 7 121648645 missense probably damaging 0.99
R5368:Usp31 UTSW 7 121661365 missense probably damaging 1.00
R5396:Usp31 UTSW 7 121667782 splice site probably null
R5456:Usp31 UTSW 7 121670277 missense probably damaging 1.00
R5475:Usp31 UTSW 7 121651526 missense probably damaging 1.00
R5497:Usp31 UTSW 7 121651601 missense probably damaging 1.00
R5872:Usp31 UTSW 7 121649475 missense probably benign 0.05
R6301:Usp31 UTSW 7 121648276 missense possibly damaging 0.76
R6688:Usp31 UTSW 7 121678330 missense probably benign 0.01
R6895:Usp31 UTSW 7 121653176 missense probably benign 0.00
R7570:Usp31 UTSW 7 121674963 missense probably damaging 1.00
R7633:Usp31 UTSW 7 121658962 missense probably damaging 0.99
R7666:Usp31 UTSW 7 121649181 missense possibly damaging 0.68
R7841:Usp31 UTSW 7 121648456 missense probably benign 0.00
R7841:Usp31 UTSW 7 121677312 missense probably damaging 0.96
R8013:Usp31 UTSW 7 121649257 missense probably damaging 0.99
R8014:Usp31 UTSW 7 121649257 missense probably damaging 0.99
R8118:Usp31 UTSW 7 121677262 missense probably damaging 1.00
R8140:Usp31 UTSW 7 121649026 missense possibly damaging 0.79
R9063:Usp31 UTSW 7 121707243 missense probably benign
X0062:Usp31 UTSW 7 121651514 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TGACTGTCACTTGGTTCCTG -3'
(R):5'- GTTGTGGTCCTGTCGTTACACC -3'

Sequencing Primer
(F):5'- GTCACTTGGTTCCTGGTGACTAC -3'
(R):5'- GTCGTTACACCAGGCTTGC -3'
Posted On 2018-10-18