Incidental Mutation 'R6875:Ikbkb'
ID 536378
Institutional Source Beutler Lab
Gene Symbol Ikbkb
Ensembl Gene ENSMUSG00000031537
Gene Name inhibitor of kappaB kinase beta
Synonyms IKK2, IKK[b], IKKbeta, IKK-beta, IKK-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6875 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 22659212-22706589 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 22665893 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 586 (D586G)
Ref Sequence ENSEMBL: ENSMUSP00000064235 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033939] [ENSMUST00000063401] [ENSMUST00000125314] [ENSMUST00000132279] [ENSMUST00000135326]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000033939
AA Change: D586G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000033939
Gene: ENSMUSG00000031537
AA Change: D586G

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 15 247 1.2e-38 PFAM
Pfam:Pkinase 15 296 1.2e-54 PFAM
Pfam:Kdo 31 176 1.3e-7 PFAM
IKKbetaNEMObind 705 742 4.71e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000063401
AA Change: D586G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000064235
Gene: ENSMUSG00000031537
AA Change: D586G

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 15 247 7.3e-39 PFAM
Pfam:Pkinase 15 296 6.9e-56 PFAM
Pfam:Kdo 44 177 3e-8 PFAM
IKKbetaNEMObind 705 737 1.83e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125314
SMART Domains Protein: ENSMUSP00000138156
Gene: ENSMUSG00000031537

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 15 248 2.8e-38 PFAM
Pfam:Pkinase 15 296 2.5e-55 PFAM
Pfam:Kdo 43 177 1.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132279
Predicted Effect probably benign
Transcript: ENSMUST00000135326
SMART Domains Protein: ENSMUSP00000138378
Gene: ENSMUSG00000031537

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 15 248 2.8e-38 PFAM
Pfam:Pkinase 15 296 2.5e-55 PFAM
Pfam:Kdo 43 177 1.4e-7 PFAM
Meta Mutation Damage Score 0.3859 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene phosphorylates the inhibitor in the inhibitor/NF-kappa-B complex, causing dissociation of the inhibitor and activation of NF-kappa-B. The encoded protein itself is found in a complex of proteins. Several transcript variants, some protein-coding and some not, have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit liver degeneration and die in midgestation. Conditional mutations that lack gene expression in lymphoid cells or epidermal keratinocytes exhibit B and T cell deficits and skin inflammation, respectively. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030458C11Rik T C 15: 12,812,068 H270R probably damaging Het
Abcb1a T C 5: 8,701,628 I336T probably benign Het
Adam19 T A 11: 46,112,875 F177I probably benign Het
Ankrd53 T C 6: 83,768,173 V455A probably damaging Het
Arrdc1 A G 2: 24,925,665 S415P probably benign Het
Atp10a T C 7: 58,797,352 L614P probably benign Het
C130060K24Rik A T 6: 65,456,336 N380I probably benign Het
Catsper1 G T 19: 5,343,963 V668F probably damaging Het
Cluh T A 11: 74,661,918 D596E probably damaging Het
Cnot10 A G 9: 114,615,107 S407P probably benign Het
Commd6 T C 14: 101,634,350 T86A probably damaging Het
D5Ertd579e A T 5: 36,604,657 probably null Het
Eif3l A G 15: 79,085,560 D252G probably damaging Het
Epha2 A T 4: 141,328,468 S962C probably damaging Het
Fcho1 C A 8: 71,714,425 probably null Het
Fgf23 G T 6: 127,073,216 G63C probably damaging Het
Flnc A T 6: 29,445,749 Y834F probably damaging Het
Gcn1l1 T C 5: 115,588,110 L608P probably damaging Het
Hdac5 T A 11: 102,202,276 E545V probably damaging Het
Hecw2 A T 1: 53,937,132 M166K probably benign Het
Il1f9 G C 2: 24,188,621 probably null Het
Ipo13 A T 4: 117,904,911 I422N possibly damaging Het
Iqgap3 GGAGAG GGAG 3: 88,112,771 probably null Het
Kat6a G A 8: 22,932,361 A896T probably benign Het
Kif28 A G 1: 179,735,994 I139T probably damaging Het
Klhl25 A G 7: 75,866,342 E332G probably damaging Het
Krt8 C T 15: 101,997,908 A389T probably benign Het
Msrb3 T C 10: 120,784,106 S175G probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo10 T C 15: 25,805,659 Y1709H probably benign Het
Nckap5 A G 1: 126,023,194 S1519P probably benign Het
Npnt T A 3: 132,909,910 D124V probably damaging Het
Nr1d1 A T 11: 98,770,836 probably null Het
Ogdh A G 11: 6,340,477 Y365C probably benign Het
Olfr1305 A T 2: 111,872,961 I298N possibly damaging Het
Phf21b A T 15: 84,787,446 C416S probably damaging Het
Prpsap1 A G 11: 116,471,438 S373P probably damaging Het
Rab28 T C 5: 41,703,534 T26A probably damaging Het
Rbbp8nl A G 2: 180,279,226 I455T probably benign Het
Rnft2 G A 5: 118,228,818 A285V possibly damaging Het
Rrp36 G T 17: 46,672,371 Q106K probably benign Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn5a A G 9: 119,486,644 L1666P probably damaging Het
Siglecf A C 7: 43,355,200 T318P probably benign Het
Slc22a1 C T 17: 12,667,305 W147* probably null Het
Smchd1 T C 17: 71,353,506 I1868V probably damaging Het
Snx21 A G 2: 164,791,902 S203G probably damaging Het
Srl T C 16: 4,482,831 K792R probably benign Het
Srrt A G 5: 137,298,673 F100S probably benign Het
Stard9 G T 2: 120,697,436 M1391I probably benign Het
Syne2 A G 12: 76,035,630 E119G probably damaging Het
Syt11 G T 3: 88,762,155 S143R possibly damaging Het
Tiparp T A 3: 65,531,642 H126Q probably benign Het
Tulp2 C A 7: 45,518,614 T150K probably benign Het
Ugt2b37 T A 5: 87,242,429 Y386F probably benign Het
Usp31 C T 7: 121,649,640 W860* probably null Het
Zfp317 A G 9: 19,643,665 R30G probably damaging Het
Zfp709 C A 8: 71,889,007 N93K possibly damaging Het
Other mutations in Ikbkb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Ikbkb APN 8 22706111 missense probably damaging 0.99
IGL00899:Ikbkb APN 8 22660447 missense possibly damaging 0.84
IGL02271:Ikbkb APN 8 22665903 missense probably benign 0.00
IGL02569:Ikbkb APN 8 22693883 missense probably damaging 1.00
IGL02610:Ikbkb APN 8 22675072 critical splice acceptor site probably null
IGL03085:Ikbkb APN 8 22682786 missense probably benign 0.03
Baby UTSW 8 22675036 missense probably damaging 1.00
Impaired UTSW 8 22666020 missense probably damaging 1.00
Kiki UTSW 8 22671642 missense possibly damaging 0.95
R0110:Ikbkb UTSW 8 22671635 nonsense probably null
R0366:Ikbkb UTSW 8 22695260 splice site probably benign
R0469:Ikbkb UTSW 8 22671635 nonsense probably null
R0510:Ikbkb UTSW 8 22671635 nonsense probably null
R1386:Ikbkb UTSW 8 22665617 missense possibly damaging 0.69
R1436:Ikbkb UTSW 8 22673403 missense probably benign 0.24
R1645:Ikbkb UTSW 8 22691066 missense probably damaging 0.98
R1695:Ikbkb UTSW 8 22673480 missense probably benign 0.00
R2118:Ikbkb UTSW 8 22667217 splice site probably benign
R2120:Ikbkb UTSW 8 22667217 splice site probably benign
R2121:Ikbkb UTSW 8 22667217 splice site probably benign
R2124:Ikbkb UTSW 8 22666020 missense probably damaging 1.00
R2124:Ikbkb UTSW 8 22667217 splice site probably benign
R2148:Ikbkb UTSW 8 22682745 missense probably damaging 1.00
R2179:Ikbkb UTSW 8 22681753 critical splice acceptor site probably null
R2897:Ikbkb UTSW 8 22669677 missense possibly damaging 0.71
R3861:Ikbkb UTSW 8 22678836 missense possibly damaging 0.94
R4019:Ikbkb UTSW 8 22671712 missense probably benign 0.03
R4723:Ikbkb UTSW 8 22669607 missense probably benign 0.24
R4962:Ikbkb UTSW 8 22681677 missense probably damaging 1.00
R5715:Ikbkb UTSW 8 22678850 missense probably damaging 1.00
R6738:Ikbkb UTSW 8 22675036 missense probably damaging 1.00
R7054:Ikbkb UTSW 8 22671642 missense possibly damaging 0.95
R7284:Ikbkb UTSW 8 22668960 missense probably benign 0.32
R7383:Ikbkb UTSW 8 22669050 missense probably benign
R7633:Ikbkb UTSW 8 22671741 missense probably benign 0.08
R7768:Ikbkb UTSW 8 22695236 missense probably damaging 0.99
R7819:Ikbkb UTSW 8 22671726 missense probably benign 0.05
R8332:Ikbkb UTSW 8 22665625 missense possibly damaging 0.79
R8369:Ikbkb UTSW 8 22691081 missense probably benign 0.32
R8421:Ikbkb UTSW 8 22678788 critical splice donor site probably null
R8934:Ikbkb UTSW 8 22660391 makesense probably null
R9249:Ikbkb UTSW 8 22681719 nonsense probably null
R9352:Ikbkb UTSW 8 22660428 missense probably benign
R9367:Ikbkb UTSW 8 22681695 missense probably damaging 1.00
R9524:Ikbkb UTSW 8 22682724 critical splice donor site probably null
R9581:Ikbkb UTSW 8 22665559 missense probably damaging 0.99
R9588:Ikbkb UTSW 8 22661394 missense unknown
Predicted Primers PCR Primer
(F):5'- CGGTTCTTCACTGTGTAGGCAAG -3'
(R):5'- AAGAGTTAGCAGGCTGGTGC -3'

Sequencing Primer
(F):5'- TTCACTGTGTAGGCAAGGCAGAG -3'
(R):5'- CAGGCTGGTGCTTAAATGTCC -3'
Posted On 2018-10-18