Incidental Mutation 'R6875:Zfp317'
ID 536382
Institutional Source Beutler Lab
Gene Symbol Zfp317
Ensembl Gene ENSMUSG00000057551
Gene Name zinc finger protein 317
Synonyms Zfp67, KRAB9, Zfp75, D230022C05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock # R6875 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 19622102-19649731 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 19643665 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 30 (R30G)
Ref Sequence ENSEMBL: ENSMUSP00000151161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079042] [ENSMUST00000208694] [ENSMUST00000213725] [ENSMUST00000215372]
AlphaFold Q8C0Q5
Predicted Effect possibly damaging
Transcript: ENSMUST00000079042
AA Change: R119G

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000078051
Gene: ENSMUSG00000057551
AA Change: R119G

DomainStartEndE-ValueType
KRAB 60 120 4.58e-32 SMART
ZnF_C2H2 223 245 1.79e-2 SMART
ZnF_C2H2 251 273 6.88e-4 SMART
ZnF_C2H2 279 301 2.24e-3 SMART
ZnF_C2H2 307 329 1.1e-2 SMART
ZnF_C2H2 335 357 7.37e-4 SMART
ZnF_C2H2 363 385 8.47e-4 SMART
ZnF_C2H2 391 413 1.3e-4 SMART
ZnF_C2H2 419 441 3.63e-3 SMART
ZnF_C2H2 447 469 3.34e-2 SMART
ZnF_C2H2 475 497 4.47e-3 SMART
ZnF_C2H2 503 525 9.73e-4 SMART
ZnF_C2H2 531 553 5.9e-3 SMART
ZnF_C2H2 559 581 1.72e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000208694
AA Change: R119G

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect probably damaging
Transcript: ENSMUST00000213725
AA Change: R30G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215372
AA Change: R119G

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030458C11Rik T C 15: 12,812,068 H270R probably damaging Het
Abcb1a T C 5: 8,701,628 I336T probably benign Het
Adam19 T A 11: 46,112,875 F177I probably benign Het
Ankrd53 T C 6: 83,768,173 V455A probably damaging Het
Arrdc1 A G 2: 24,925,665 S415P probably benign Het
Atp10a T C 7: 58,797,352 L614P probably benign Het
C130060K24Rik A T 6: 65,456,336 N380I probably benign Het
Catsper1 G T 19: 5,343,963 V668F probably damaging Het
Cluh T A 11: 74,661,918 D596E probably damaging Het
Cnot10 A G 9: 114,615,107 S407P probably benign Het
Commd6 T C 14: 101,634,350 T86A probably damaging Het
D5Ertd579e A T 5: 36,604,657 probably null Het
Eif3l A G 15: 79,085,560 D252G probably damaging Het
Epha2 A T 4: 141,328,468 S962C probably damaging Het
Fcho1 C A 8: 71,714,425 probably null Het
Fgf23 G T 6: 127,073,216 G63C probably damaging Het
Flnc A T 6: 29,445,749 Y834F probably damaging Het
Gcn1l1 T C 5: 115,588,110 L608P probably damaging Het
Hdac5 T A 11: 102,202,276 E545V probably damaging Het
Hecw2 A T 1: 53,937,132 M166K probably benign Het
Ikbkb T C 8: 22,665,893 D586G probably damaging Het
Il1f9 G C 2: 24,188,621 probably null Het
Ipo13 A T 4: 117,904,911 I422N possibly damaging Het
Iqgap3 GGAGAG GGAG 3: 88,112,771 probably null Het
Kat6a G A 8: 22,932,361 A896T probably benign Het
Kif28 A G 1: 179,735,994 I139T probably damaging Het
Klhl25 A G 7: 75,866,342 E332G probably damaging Het
Krt8 C T 15: 101,997,908 A389T probably benign Het
Msrb3 T C 10: 120,784,106 S175G probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo10 T C 15: 25,805,659 Y1709H probably benign Het
Nckap5 A G 1: 126,023,194 S1519P probably benign Het
Npnt T A 3: 132,909,910 D124V probably damaging Het
Nr1d1 A T 11: 98,770,836 probably null Het
Ogdh A G 11: 6,340,477 Y365C probably benign Het
Olfr1305 A T 2: 111,872,961 I298N possibly damaging Het
Phf21b A T 15: 84,787,446 C416S probably damaging Het
Prpsap1 A G 11: 116,471,438 S373P probably damaging Het
Rab28 T C 5: 41,703,534 T26A probably damaging Het
Rbbp8nl A G 2: 180,279,226 I455T probably benign Het
Rnft2 G A 5: 118,228,818 A285V possibly damaging Het
Rrp36 G T 17: 46,672,371 Q106K probably benign Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn5a A G 9: 119,486,644 L1666P probably damaging Het
Siglecf A C 7: 43,355,200 T318P probably benign Het
Slc22a1 C T 17: 12,667,305 W147* probably null Het
Smchd1 T C 17: 71,353,506 I1868V probably damaging Het
Snx21 A G 2: 164,791,902 S203G probably damaging Het
Srl T C 16: 4,482,831 K792R probably benign Het
Srrt A G 5: 137,298,673 F100S probably benign Het
Stard9 G T 2: 120,697,436 M1391I probably benign Het
Syne2 A G 12: 76,035,630 E119G probably damaging Het
Syt11 G T 3: 88,762,155 S143R possibly damaging Het
Tiparp T A 3: 65,531,642 H126Q probably benign Het
Tulp2 C A 7: 45,518,614 T150K probably benign Het
Ugt2b37 T A 5: 87,242,429 Y386F probably benign Het
Usp31 C T 7: 121,649,640 W860* probably null Het
Zfp709 C A 8: 71,889,007 N93K possibly damaging Het
Other mutations in Zfp317
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02425:Zfp317 APN 9 19643613 nonsense probably null
R1520:Zfp317 UTSW 9 19647848 missense possibly damaging 0.95
R1646:Zfp317 UTSW 9 19647312 missense probably damaging 1.00
R1860:Zfp317 UTSW 9 19641984 missense possibly damaging 0.85
R2029:Zfp317 UTSW 9 19645236 missense probably benign 0.13
R2364:Zfp317 UTSW 9 19647735 missense probably benign 0.01
R4006:Zfp317 UTSW 9 19648037 missense possibly damaging 0.82
R4031:Zfp317 UTSW 9 19646712 missense possibly damaging 0.53
R4293:Zfp317 UTSW 9 19646694 splice site probably null
R4897:Zfp317 UTSW 9 19646847 missense probably benign 0.28
R5593:Zfp317 UTSW 9 19647288 missense probably damaging 1.00
R6077:Zfp317 UTSW 9 19646888 missense probably benign 0.00
R6573:Zfp317 UTSW 9 19645254 missense probably damaging 0.99
R6652:Zfp317 UTSW 9 19647039 missense probably damaging 1.00
R6750:Zfp317 UTSW 9 19647804 missense probably damaging 1.00
R7688:Zfp317 UTSW 9 19647955 missense probably damaging 1.00
R8054:Zfp317 UTSW 9 19641969 missense probably benign 0.00
R8900:Zfp317 UTSW 9 19647412 nonsense probably null
R8927:Zfp317 UTSW 9 19641225 start codon destroyed probably null
R8928:Zfp317 UTSW 9 19641225 start codon destroyed probably null
R9052:Zfp317 UTSW 9 19645272 missense probably benign 0.03
R9176:Zfp317 UTSW 9 19647867 missense probably damaging 1.00
R9210:Zfp317 UTSW 9 19647146 nonsense probably null
R9212:Zfp317 UTSW 9 19647146 nonsense probably null
Z1177:Zfp317 UTSW 9 19647030 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTAAGTCAGCCTTATCCACG -3'
(R):5'- TGTTATGACACAGCCTACACC -3'

Sequencing Primer
(F):5'- GTCAGCCTTATCCACGTACAG -3'
(R):5'- ATGGCACCAATCCCTTTGAACTG -3'
Posted On 2018-10-18