Mutagenetix > Incidental Mutation

Incidental Mutation 'R6875:Cnot10'

536383

Institutional Source

Beutler Lab

Gene Symbol

Cnot10

Ensembl Gene

ENSMUSG00000056167

Gene Name

CCR4-NOT transcription complex, subunit 10

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6875 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

114585878-114640184 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 114615107 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 407 (S407P)

Ref Sequence

ENSEMBL: ENSMUSP00000064840 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070117] [ENSMUST00000215155] [ENSMUST00000216785] [ENSMUST00000217148]

AlphaFold

Q8BH15

Predicted Effect

probably benign
Transcript: ENSMUST00000070117
AA Change: S407P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000064840
Gene: ENSMUSG00000056167
AA Change: S407P

Domain	Start	End	E-Value	Type
Blast:TPR	27	60	2e-10	BLAST
coiled coil region	73	107	N/A	INTRINSIC
TPR	110	143	4.32e1	SMART
low complexity region	182	198	N/A	INTRINSIC
TPR	293	326	3.37e-2	SMART
TPR	355	388	6.75e1	SMART
low complexity region	496	508	N/A	INTRINSIC
TPR	643	676	7.87e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000215155

Predicted Effect

probably benign
Transcript: ENSMUST00000216785

Predicted Effect

unknown
Transcript: ENSMUST00000217148
AA Change: F289S

Meta Mutation Damage Score

0.0613

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.2%

Validation Efficiency

98% (58/59)

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6030458C11Rik	T	C	15: 12,812,068	H270R	probably damaging	Het
Abcb1a	T	C	5: 8,701,628	I336T	probably benign	Het
Adam19	T	A	11: 46,112,875	F177I	probably benign	Het
Ankrd53	T	C	6: 83,768,173	V455A	probably damaging	Het
Arrdc1	A	G	2: 24,925,665	S415P	probably benign	Het
Atp10a	T	C	7: 58,797,352	L614P	probably benign	Het
C130060K24Rik	A	T	6: 65,456,336	N380I	probably benign	Het
Catsper1	G	T	19: 5,343,963	V668F	probably damaging	Het
Cluh	T	A	11: 74,661,918	D596E	probably damaging	Het
Commd6	T	C	14: 101,634,350	T86A	probably damaging	Het
D5Ertd579e	A	T	5: 36,604,657		probably null	Het
Eif3l	A	G	15: 79,085,560	D252G	probably damaging	Het
Epha2	A	T	4: 141,328,468	S962C	probably damaging	Het
Fcho1	C	A	8: 71,714,425		probably null	Het
Fgf23	G	T	6: 127,073,216	G63C	probably damaging	Het
Flnc	A	T	6: 29,445,749	Y834F	probably damaging	Het
Gcn1l1	T	C	5: 115,588,110	L608P	probably damaging	Het
Hdac5	T	A	11: 102,202,276	E545V	probably damaging	Het
Hecw2	A	T	1: 53,937,132	M166K	probably benign	Het
Ikbkb	T	C	8: 22,665,893	D586G	probably damaging	Het
Il1f9	G	C	2: 24,188,621		probably null	Het
Ipo13	A	T	4: 117,904,911	I422N	possibly damaging	Het
Iqgap3	GGAGAG	GGAG	3: 88,112,771		probably null	Het
Kat6a	G	A	8: 22,932,361	A896T	probably benign	Het
Kif28	A	G	1: 179,735,994	I139T	probably damaging	Het
Klhl25	A	G	7: 75,866,342	E332G	probably damaging	Het
Krt8	C	T	15: 101,997,908	A389T	probably benign	Het
Msrb3	T	C	10: 120,784,106	S175G	probably benign	Het
Muc5ac	C	T	7: 141,809,744		probably benign	Het
Myo10	T	C	15: 25,805,659	Y1709H	probably benign	Het
Nckap5	A	G	1: 126,023,194	S1519P	probably benign	Het
Npnt	T	A	3: 132,909,910	D124V	probably damaging	Het
Nr1d1	A	T	11: 98,770,836		probably null	Het
Ogdh	A	G	11: 6,340,477	Y365C	probably benign	Het
Olfr1305	A	T	2: 111,872,961	I298N	possibly damaging	Het
Phf21b	A	T	15: 84,787,446	C416S	probably damaging	Het
Prpsap1	A	G	11: 116,471,438	S373P	probably damaging	Het
Rab28	T	C	5: 41,703,534	T26A	probably damaging	Het
Rbbp8nl	A	G	2: 180,279,226	I455T	probably benign	Het
Rnft2	G	A	5: 118,228,818	A285V	possibly damaging	Het
Rrp36	G	T	17: 46,672,371	Q106K	probably benign	Het
Rsf1	CG	CGACGGCGGAG	7: 97,579,908		probably benign	Het
Runx2	G	A	17: 44,814,192	P80L	probably damaging	Het
Scn5a	A	G	9: 119,486,644	L1666P	probably damaging	Het
Siglecf	A	C	7: 43,355,200	T318P	probably benign	Het
Slc22a1	C	T	17: 12,667,305	W147*	probably null	Het
Smchd1	T	C	17: 71,353,506	I1868V	probably damaging	Het
Snx21	A	G	2: 164,791,902	S203G	probably damaging	Het
Srl	T	C	16: 4,482,831	K792R	probably benign	Het
Srrt	A	G	5: 137,298,673	F100S	probably benign	Het
Stard9	G	T	2: 120,697,436	M1391I	probably benign	Het
Syne2	A	G	12: 76,035,630	E119G	probably damaging	Het
Syt11	G	T	3: 88,762,155	S143R	possibly damaging	Het
Tiparp	T	A	3: 65,531,642	H126Q	probably benign	Het
Tulp2	C	A	7: 45,518,614	T150K	probably benign	Het
Ugt2b37	T	A	5: 87,242,429	Y386F	probably benign	Het
Usp31	C	T	7: 121,649,640	W860*	probably null	Het
Zfp317	A	G	9: 19,643,665	R30G	probably damaging	Het
Zfp709	C	A	8: 71,889,007	N93K	possibly damaging	Het

Other mutations in Cnot10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01313:Cnot10	APN	9	114631855	missense	probably benign	0.19
IGL02004:Cnot10	APN	9	114622930	missense	probably damaging	1.00
IGL03297:Cnot10	APN	9	114598716	missense	possibly damaging	0.87
BB003:Cnot10	UTSW	9	114617815	missense	probably damaging	1.00
BB013:Cnot10	UTSW	9	114617815	missense	probably damaging	1.00
R0348:Cnot10	UTSW	9	114598770	missense	probably benign	0.10
R0390:Cnot10	UTSW	9	114629150	nonsense	probably null
R1256:Cnot10	UTSW	9	114610681	missense	probably damaging	1.00
R1471:Cnot10	UTSW	9	114591551	missense	probably benign	0.00
R1607:Cnot10	UTSW	9	114629095	nonsense	probably null
R1721:Cnot10	UTSW	9	114614999	missense	probably benign
R1741:Cnot10	UTSW	9	114597824	missense	possibly damaging	0.87
R2116:Cnot10	UTSW	9	114626436	missense	probably damaging	1.00
R4073:Cnot10	UTSW	9	114622947	missense	possibly damaging	0.91
R4074:Cnot10	UTSW	9	114622947	missense	possibly damaging	0.91
R4075:Cnot10	UTSW	9	114622947	missense	possibly damaging	0.91
R4365:Cnot10	UTSW	9	114631881	nonsense	probably null
R4383:Cnot10	UTSW	9	114631881	nonsense	probably null
R4385:Cnot10	UTSW	9	114631881	nonsense	probably null
R4398:Cnot10	UTSW	9	114631881	nonsense	probably null
R4423:Cnot10	UTSW	9	114617920	missense	probably damaging	1.00
R4859:Cnot10	UTSW	9	114627464	missense	probably damaging	1.00
R4916:Cnot10	UTSW	9	114629134	missense	possibly damaging	0.72
R4927:Cnot10	UTSW	9	114617944	missense	probably damaging	1.00
R5153:Cnot10	UTSW	9	114613735	missense	probably damaging	1.00
R5677:Cnot10	UTSW	9	114629093	missense	probably damaging	1.00
R5702:Cnot10	UTSW	9	114629010	missense	probably damaging	0.98
R5790:Cnot10	UTSW	9	114625917	splice site	probably null
R6190:Cnot10	UTSW	9	114632723	missense	probably damaging	1.00
R6353:Cnot10	UTSW	9	114597546	missense	probably damaging	1.00
R6463:Cnot10	UTSW	9	114625902	missense	probably damaging	1.00
R6819:Cnot10	UTSW	9	114615055	missense	probably benign	0.10
R6849:Cnot10	UTSW	9	114631936	missense	probably benign	0.01
R7071:Cnot10	UTSW	9	114617719	splice site	probably null
R7408:Cnot10	UTSW	9	114631826	missense	probably benign	0.33
R7412:Cnot10	UTSW	9	114625903	missense	probably damaging	1.00
R7645:Cnot10	UTSW	9	114613637	missense	probably benign
R7706:Cnot10	UTSW	9	114593438	missense	probably damaging	0.98
R7926:Cnot10	UTSW	9	114617815	missense	probably damaging	1.00
R8187:Cnot10	UTSW	9	114597488	nonsense	probably null
R8322:Cnot10	UTSW	9	114627469	missense	probably damaging	0.99
R8412:Cnot10	UTSW	9	114610670	missense	probably benign	0.11
R8904:Cnot10	UTSW	9	114601355	missense	probably benign	0.06
R9340:Cnot10	UTSW	9	114631829	missense	probably benign	0.01
X0062:Cnot10	UTSW	9	114615134	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- TACTGCCCACTAAAAGCACGG -3'
(R):5'- AGGGTGGGGAAATGTAGTTTCA -3'

Sequencing Primer
(F):5'- TAAAAGCACGGCACCGACAG -3'
(R):5'- CAGGTGCACACGTGGTACATATTC -3'

Posted On

2018-10-18