Incidental Mutation 'R6875:Msrb3'
ID 536385
Institutional Source Beutler Lab
Gene Symbol Msrb3
Ensembl Gene ENSMUSG00000051236
Gene Name methionine sulfoxide reductase B3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock # R6875 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 120781096-120899101 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 120784106 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 175 (S175G)
Ref Sequence ENSEMBL: ENSMUSP00000089781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092143] [ENSMUST00000130950]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000092143
AA Change: S175G

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000089781
Gene: ENSMUSG00000051236
AA Change: S175G

DomainStartEndE-ValueType
Pfam:SelR 41 161 1.9e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130950
AA Change: S103G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115269
Gene: ENSMUSG00000051236
AA Change: S103G

DomainStartEndE-ValueType
Pfam:SelR 20 90 7.1e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the reduction of methionine sulfoxide to methionine. This enzyme acts as a monomer and requires zinc as a cofactor. Several transcript variants encoding two different isoforms have been found for this gene. One of the isoforms localizes to mitochondria while the other localizes to endoplasmic reticula. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit deafness with cochlear inner and outer hair cell degeneration and increased apoptosis in the organ of Corti. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030458C11Rik T C 15: 12,812,068 H270R probably damaging Het
Abcb1a T C 5: 8,701,628 I336T probably benign Het
Adam19 T A 11: 46,112,875 F177I probably benign Het
Ankrd53 T C 6: 83,768,173 V455A probably damaging Het
Arrdc1 A G 2: 24,925,665 S415P probably benign Het
Atp10a T C 7: 58,797,352 L614P probably benign Het
C130060K24Rik A T 6: 65,456,336 N380I probably benign Het
Catsper1 G T 19: 5,343,963 V668F probably damaging Het
Cluh T A 11: 74,661,918 D596E probably damaging Het
Cnot10 A G 9: 114,615,107 S407P probably benign Het
Commd6 T C 14: 101,634,350 T86A probably damaging Het
D5Ertd579e A T 5: 36,604,657 probably null Het
Eif3l A G 15: 79,085,560 D252G probably damaging Het
Epha2 A T 4: 141,328,468 S962C probably damaging Het
Fcho1 C A 8: 71,714,425 probably null Het
Fgf23 G T 6: 127,073,216 G63C probably damaging Het
Flnc A T 6: 29,445,749 Y834F probably damaging Het
Gcn1l1 T C 5: 115,588,110 L608P probably damaging Het
Hdac5 T A 11: 102,202,276 E545V probably damaging Het
Hecw2 A T 1: 53,937,132 M166K probably benign Het
Ikbkb T C 8: 22,665,893 D586G probably damaging Het
Il1f9 G C 2: 24,188,621 probably null Het
Ipo13 A T 4: 117,904,911 I422N possibly damaging Het
Iqgap3 GGAGAG GGAG 3: 88,112,771 probably null Het
Kat6a G A 8: 22,932,361 A896T probably benign Het
Kif28 A G 1: 179,735,994 I139T probably damaging Het
Klhl25 A G 7: 75,866,342 E332G probably damaging Het
Krt8 C T 15: 101,997,908 A389T probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo10 T C 15: 25,805,659 Y1709H probably benign Het
Nckap5 A G 1: 126,023,194 S1519P probably benign Het
Npnt T A 3: 132,909,910 D124V probably damaging Het
Nr1d1 A T 11: 98,770,836 probably null Het
Ogdh A G 11: 6,340,477 Y365C probably benign Het
Olfr1305 A T 2: 111,872,961 I298N possibly damaging Het
Phf21b A T 15: 84,787,446 C416S probably damaging Het
Prpsap1 A G 11: 116,471,438 S373P probably damaging Het
Rab28 T C 5: 41,703,534 T26A probably damaging Het
Rbbp8nl A G 2: 180,279,226 I455T probably benign Het
Rnft2 G A 5: 118,228,818 A285V possibly damaging Het
Rrp36 G T 17: 46,672,371 Q106K probably benign Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn5a A G 9: 119,486,644 L1666P probably damaging Het
Siglecf A C 7: 43,355,200 T318P probably benign Het
Slc22a1 C T 17: 12,667,305 W147* probably null Het
Smchd1 T C 17: 71,353,506 I1868V probably damaging Het
Snx21 A G 2: 164,791,902 S203G probably damaging Het
Srl T C 16: 4,482,831 K792R probably benign Het
Srrt A G 5: 137,298,673 F100S probably benign Het
Stard9 G T 2: 120,697,436 M1391I probably benign Het
Syne2 A G 12: 76,035,630 E119G probably damaging Het
Syt11 G T 3: 88,762,155 S143R possibly damaging Het
Tiparp T A 3: 65,531,642 H126Q probably benign Het
Tulp2 C A 7: 45,518,614 T150K probably benign Het
Ugt2b37 T A 5: 87,242,429 Y386F probably benign Het
Usp31 C T 7: 121,649,640 W860* probably null Het
Zfp317 A G 9: 19,643,665 R30G probably damaging Het
Zfp709 C A 8: 71,889,007 N93K possibly damaging Het
Other mutations in Msrb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02546:Msrb3 APN 10 120850001 missense possibly damaging 0.94
IGL03303:Msrb3 APN 10 120784141 missense probably benign 0.03
R0138:Msrb3 UTSW 10 120851987 missense probably damaging 1.00
R1073:Msrb3 UTSW 10 120784136 missense possibly damaging 0.96
R1946:Msrb3 UTSW 10 120852008 missense probably damaging 1.00
R2113:Msrb3 UTSW 10 120852080 missense possibly damaging 0.66
R3623:Msrb3 UTSW 10 120784198 missense probably damaging 1.00
R3741:Msrb3 UTSW 10 120784214 missense probably damaging 1.00
R4606:Msrb3 UTSW 10 120849997 missense probably damaging 1.00
R6397:Msrb3 UTSW 10 120791451 missense probably damaging 1.00
R7207:Msrb3 UTSW 10 120791400 critical splice donor site probably null
R8729:Msrb3 UTSW 10 120852069 missense probably null 0.95
Predicted Primers PCR Primer
(F):5'- GTTCTGGACCTAGTCAACAGC -3'
(R):5'- AAAGCCCACTTGGTGCATGTG -3'

Sequencing Primer
(F):5'- CAGAACTGCCATCTAGACGAGAG -3'
(R):5'- CGACCGGCAAAAGATACT -3'
Posted On 2018-10-18