Mutagenetix > Incidental Mutation

Incidental Mutation 'R6875:Cluh'

536388

Institutional Source

Beutler Lab

Gene Symbol

Cluh

Ensembl Gene

ENSMUSG00000020741

Gene Name

clustered mitochondria (cluA/CLU1) homolog

Synonyms

1300001I01Rik

MMRRC Submission

044971-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.208) question?

Stock #

R6875 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

74649495-74670847 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 74661918 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 596 (D596E)

Ref Sequence

ENSEMBL: ENSMUSP00000113371 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092915] [ENSMUST00000117818]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000092915
AA Change: D596E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000090593
Gene: ENSMUSG00000020741
AA Change: D596E

Domain	Start	End	E-Value	Type
Pfam:CLU_N	104	177	3.1e-28	PFAM
Pfam:CLU	394	614	3.4e-89	PFAM
Pfam:eIF3_p135	806	988	1.3e-58	PFAM
Pfam:TPR_10	1059	1100	2.9e-7	PFAM
low complexity region	1114	1125	N/A	INTRINSIC
Pfam:TPR_12	1140	1218	1.7e-10	PFAM
low complexity region	1316	1334	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000117818
AA Change: D596E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113371
Gene: ENSMUSG00000020741
AA Change: D596E

Domain	Start	End	E-Value	Type
Pfam:CLU_N	102	177	9.8e-30	PFAM
Pfam:CLU	394	615	5.3e-92	PFAM
Pfam:eIF3_p135	796	938	2.9e-38	PFAM
Pfam:TPR_10	1008	1049	9.5e-7	PFAM
low complexity region	1063	1074	N/A	INTRINSIC
Pfam:TPR_12	1089	1167	1.1e-9	PFAM
low complexity region	1265	1283	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.2%

Validation Efficiency

98% (58/59)

MGI Phenotype

PHENOTYPE: Constitutive homozygous KO affects liver mitochondrial function and leads to neonatal lethality. Conditional homozygous KO in the adult liver affects cellular respiration under energy stress conditions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6030458C11Rik	T	C	15: 12,812,068	H270R	probably damaging	Het
Abcb1a	T	C	5: 8,701,628	I336T	probably benign	Het
Adam19	T	A	11: 46,112,875	F177I	probably benign	Het
Ankrd53	T	C	6: 83,768,173	V455A	probably damaging	Het
Arrdc1	A	G	2: 24,925,665	S415P	probably benign	Het
Atp10a	T	C	7: 58,797,352	L614P	probably benign	Het
C130060K24Rik	A	T	6: 65,456,336	N380I	probably benign	Het
Catsper1	G	T	19: 5,343,963	V668F	probably damaging	Het
Cnot10	A	G	9: 114,615,107	S407P	probably benign	Het
Commd6	T	C	14: 101,634,350	T86A	probably damaging	Het
D5Ertd579e	A	T	5: 36,604,657		probably null	Het
Eif3l	A	G	15: 79,085,560	D252G	probably damaging	Het
Epha2	A	T	4: 141,328,468	S962C	probably damaging	Het
Fcho1	C	A	8: 71,714,425		probably null	Het
Fgf23	G	T	6: 127,073,216	G63C	probably damaging	Het
Flnc	A	T	6: 29,445,749	Y834F	probably damaging	Het
Gcn1l1	T	C	5: 115,588,110	L608P	probably damaging	Het
Hdac5	T	A	11: 102,202,276	E545V	probably damaging	Het
Hecw2	A	T	1: 53,937,132	M166K	probably benign	Het
Ikbkb	T	C	8: 22,665,893	D586G	probably damaging	Het
Il1f9	G	C	2: 24,188,621		probably null	Het
Ipo13	A	T	4: 117,904,911	I422N	possibly damaging	Het
Iqgap3	GGAGAG	GGAG	3: 88,112,771		probably null	Het
Kat6a	G	A	8: 22,932,361	A896T	probably benign	Het
Kif28	A	G	1: 179,735,994	I139T	probably damaging	Het
Klhl25	A	G	7: 75,866,342	E332G	probably damaging	Het
Krt8	C	T	15: 101,997,908	A389T	probably benign	Het
Msrb3	T	C	10: 120,784,106	S175G	probably benign	Het
Muc5ac	C	T	7: 141,809,744		probably benign	Het
Myo10	T	C	15: 25,805,659	Y1709H	probably benign	Het
Nckap5	A	G	1: 126,023,194	S1519P	probably benign	Het
Npnt	T	A	3: 132,909,910	D124V	probably damaging	Het
Nr1d1	A	T	11: 98,770,836		probably null	Het
Ogdh	A	G	11: 6,340,477	Y365C	probably benign	Het
Olfr1305	A	T	2: 111,872,961	I298N	possibly damaging	Het
Phf21b	A	T	15: 84,787,446	C416S	probably damaging	Het
Prpsap1	A	G	11: 116,471,438	S373P	probably damaging	Het
Rab28	T	C	5: 41,703,534	T26A	probably damaging	Het
Rbbp8nl	A	G	2: 180,279,226	I455T	probably benign	Het
Rnft2	G	A	5: 118,228,818	A285V	possibly damaging	Het
Rrp36	G	T	17: 46,672,371	Q106K	probably benign	Het
Rsf1	CG	CGACGGCGGAG	7: 97,579,908		probably benign	Het
Runx2	G	A	17: 44,814,192	P80L	probably damaging	Het
Scn5a	A	G	9: 119,486,644	L1666P	probably damaging	Het
Siglecf	A	C	7: 43,355,200	T318P	probably benign	Het
Slc22a1	C	T	17: 12,667,305	W147*	probably null	Het
Smchd1	T	C	17: 71,353,506	I1868V	probably damaging	Het
Snx21	A	G	2: 164,791,902	S203G	probably damaging	Het
Srl	T	C	16: 4,482,831	K792R	probably benign	Het
Srrt	A	G	5: 137,298,673	F100S	probably benign	Het
Stard9	G	T	2: 120,697,436	M1391I	probably benign	Het
Syne2	A	G	12: 76,035,630	E119G	probably damaging	Het
Syt11	G	T	3: 88,762,155	S143R	possibly damaging	Het
Tiparp	T	A	3: 65,531,642	H126Q	probably benign	Het
Tulp2	C	A	7: 45,518,614	T150K	probably benign	Het
Ugt2b37	T	A	5: 87,242,429	Y386F	probably benign	Het
Usp31	C	T	7: 121,649,640	W860*	probably null	Het
Zfp317	A	G	9: 19,643,665	R30G	probably damaging	Het
Zfp709	C	A	8: 71,889,007	N93K	possibly damaging	Het

Other mutations in Cluh

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Cluh	APN	11	74664064	missense	probably benign	0.28
IGL00858:Cluh	APN	11	74659605	missense	possibly damaging	0.86
IGL01380:Cluh	APN	11	74665946	missense	probably benign	0.04
IGL02402:Cluh	APN	11	74657171	missense	probably damaging	1.00
IGL02620:Cluh	APN	11	74665067	nonsense	probably null
IGL02990:Cluh	APN	11	74667765	splice site	probably null
IGL03163:Cluh	APN	11	74666068	missense	probably benign	0.44
IGL03208:Cluh	APN	11	74669506	splice site	probably null
IGL03293:Cluh	APN	11	74665752	missense	probably benign	0.03
IGL03408:Cluh	APN	11	74665953	missense	probably benign	0.06
spent	UTSW	11	74660372	missense	probably damaging	1.00
FR4342:Cluh	UTSW	11	74669526	small insertion	probably benign
FR4342:Cluh	UTSW	11	74669524	small insertion	probably benign
FR4449:Cluh	UTSW	11	74669532	small insertion	probably benign
FR4589:Cluh	UTSW	11	74669531	small insertion	probably benign
FR4737:Cluh	UTSW	11	74669524	small insertion	probably benign
FR4737:Cluh	UTSW	11	74669519	small insertion	probably benign
FR4737:Cluh	UTSW	11	74669514	small insertion	probably benign
FR4737:Cluh	UTSW	11	74669533	small insertion	probably benign
FR4976:Cluh	UTSW	11	74669520	small insertion	probably benign
R0147:Cluh	UTSW	11	74665938	missense	probably damaging	1.00
R0153:Cluh	UTSW	11	74657350	splice site	probably benign
R0506:Cluh	UTSW	11	74664894	missense	probably benign	0.20
R0526:Cluh	UTSW	11	74665986	missense	probably benign	0.05
R0834:Cluh	UTSW	11	74663805	missense	probably benign	0.02
R1873:Cluh	UTSW	11	74662076	missense	possibly damaging	0.72
R1991:Cluh	UTSW	11	74659529	nonsense	probably null
R1992:Cluh	UTSW	11	74660002	missense	probably damaging	1.00
R2095:Cluh	UTSW	11	74661724	nonsense	probably null
R2101:Cluh	UTSW	11	74660502	splice site	probably benign
R2103:Cluh	UTSW	11	74659529	nonsense	probably null
R2220:Cluh	UTSW	11	74667121	missense	probably damaging	1.00
R3702:Cluh	UTSW	11	74665356	missense	probably benign
R3853:Cluh	UTSW	11	74656453	missense	probably benign	0.00
R3900:Cluh	UTSW	11	74667104	missense	probably benign	0.29
R4891:Cluh	UTSW	11	74665059	missense	possibly damaging	0.51
R4895:Cluh	UTSW	11	74667405	missense	probably damaging	1.00
R5056:Cluh	UTSW	11	74661946	missense	probably damaging	1.00
R5089:Cluh	UTSW	11	74660372	missense	probably damaging	1.00
R5217:Cluh	UTSW	11	74659705	missense	probably damaging	1.00
R5346:Cluh	UTSW	11	74665218	missense	probably damaging	1.00
R5382:Cluh	UTSW	11	74665109	intron	probably benign
R5516:Cluh	UTSW	11	74660444	missense	probably damaging	1.00
R5809:Cluh	UTSW	11	74661700	missense	probably damaging	1.00
R6146:Cluh	UTSW	11	74667228	splice site	probably null
R6326:Cluh	UTSW	11	74666242	missense	probably benign	0.10
R6541:Cluh	UTSW	11	74657214	missense	probably damaging	1.00
R6674:Cluh	UTSW	11	74666227	missense	probably damaging	1.00
R6870:Cluh	UTSW	11	74665384	missense	probably damaging	1.00
R7086:Cluh	UTSW	11	74667340	missense	possibly damaging	0.46
R7225:Cluh	UTSW	11	74666406	splice site	probably null
R7310:Cluh	UTSW	11	74669459	missense	probably benign	0.10
R7317:Cluh	UTSW	11	74665704	missense	possibly damaging	0.90
R7674:Cluh	UTSW	11	74667720	missense	probably damaging	1.00
R7941:Cluh	UTSW	11	74659757	missense	probably benign	0.00
R9061:Cluh	UTSW	11	74660366	missense	possibly damaging	0.73
R9326:Cluh	UTSW	11	74664076	missense	probably benign	0.00
R9489:Cluh	UTSW	11	74667946	missense	possibly damaging	0.92
R9605:Cluh	UTSW	11	74667946	missense	possibly damaging	0.92
RF020:Cluh	UTSW	11	74669538	small insertion	probably benign
RF032:Cluh	UTSW	11	74669515	small insertion	probably benign
X0028:Cluh	UTSW	11	74663466	missense	probably benign	0.26
Z1177:Cluh	UTSW	11	74667754	missense	possibly damaging	0.82
Z1186:Cluh	UTSW	11	74669531	small insertion	probably benign
Z1186:Cluh	UTSW	11	74669517	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669514	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669516	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669517	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669520	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669521	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669524	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669529	small insertion	probably benign
Z1188:Cluh	UTSW	11	74669517	small insertion	probably benign
Z1189:Cluh	UTSW	11	74669514	frame shift	probably null
Z1189:Cluh	UTSW	11	74669531	small insertion	probably benign
Z1189:Cluh	UTSW	11	74669530	nonsense	probably null
Z1189:Cluh	UTSW	11	74669529	small insertion	probably benign
Z1189:Cluh	UTSW	11	74669523	small insertion	probably benign
Z1189:Cluh	UTSW	11	74669519	small insertion	probably benign
Z1189:Cluh	UTSW	11	74669517	small insertion	probably benign
Z1190:Cluh	UTSW	11	74669530	small insertion	probably benign
Z1190:Cluh	UTSW	11	74669518	small insertion	probably benign
Z1190:Cluh	UTSW	11	74669517	small insertion	probably benign
Z1190:Cluh	UTSW	11	74669532	small insertion	probably benign
Z1191:Cluh	UTSW	11	74669523	small insertion	probably benign
Z1191:Cluh	UTSW	11	74669517	small insertion	probably benign
Z1191:Cluh	UTSW	11	74669514	small insertion	probably benign
Z1191:Cluh	UTSW	11	74669530	small insertion	probably benign
Z1191:Cluh	UTSW	11	74669526	small insertion	probably benign
Z1192:Cluh	UTSW	11	74669525	small insertion	probably benign
Z1192:Cluh	UTSW	11	74669517	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- ACCAGGAGCAGAGTGTCATC -3'
(R):5'- CCCTGTCAGTCTAGTTCAACAG -3'

Sequencing Primer
(F):5'- AGCAGAGTGTCATCTATGGCTCC -3'
(R):5'- TGTCAGTCTAGTTCAACAGCAGCC -3'

Posted On

2018-10-18