Incidental Mutation 'R6875:Phf21b'
ID 536397
Institutional Source Beutler Lab
Gene Symbol Phf21b
Ensembl Gene ENSMUSG00000016624
Gene Name PHD finger protein 21B
Synonyms A730032D07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6875 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 84785381-84856049 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 84787446 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 416 (C416S)
Ref Sequence ENSEMBL: ENSMUSP00000125355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016768] [ENSMUST00000159939] [ENSMUST00000162044]
AlphaFold Q8C966
Predicted Effect probably damaging
Transcript: ENSMUST00000016768
AA Change: C404S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000016768
Gene: ENSMUSG00000016624
AA Change: C404S

DomainStartEndE-ValueType
low complexity region 188 202 N/A INTRINSIC
PHD 297 340 6.64e-10 SMART
coiled coil region 368 403 N/A INTRINSIC
low complexity region 456 467 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159939
AA Change: C416S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125355
Gene: ENSMUSG00000016624
AA Change: C416S

DomainStartEndE-ValueType
low complexity region 200 214 N/A INTRINSIC
PHD 309 352 6.64e-10 SMART
coiled coil region 380 415 N/A INTRINSIC
low complexity region 468 479 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162044
SMART Domains Protein: ENSMUSP00000124941
Gene: ENSMUSG00000016624

DomainStartEndE-ValueType
low complexity region 200 214 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030458C11Rik T C 15: 12,812,068 H270R probably damaging Het
Abcb1a T C 5: 8,701,628 I336T probably benign Het
Adam19 T A 11: 46,112,875 F177I probably benign Het
Ankrd53 T C 6: 83,768,173 V455A probably damaging Het
Arrdc1 A G 2: 24,925,665 S415P probably benign Het
Atp10a T C 7: 58,797,352 L614P probably benign Het
C130060K24Rik A T 6: 65,456,336 N380I probably benign Het
Catsper1 G T 19: 5,343,963 V668F probably damaging Het
Cluh T A 11: 74,661,918 D596E probably damaging Het
Cnot10 A G 9: 114,615,107 S407P probably benign Het
Commd6 T C 14: 101,634,350 T86A probably damaging Het
D5Ertd579e A T 5: 36,604,657 probably null Het
Eif3l A G 15: 79,085,560 D252G probably damaging Het
Epha2 A T 4: 141,328,468 S962C probably damaging Het
Fcho1 C A 8: 71,714,425 probably null Het
Fgf23 G T 6: 127,073,216 G63C probably damaging Het
Flnc A T 6: 29,445,749 Y834F probably damaging Het
Gcn1l1 T C 5: 115,588,110 L608P probably damaging Het
Hdac5 T A 11: 102,202,276 E545V probably damaging Het
Hecw2 A T 1: 53,937,132 M166K probably benign Het
Ikbkb T C 8: 22,665,893 D586G probably damaging Het
Il1f9 G C 2: 24,188,621 probably null Het
Ipo13 A T 4: 117,904,911 I422N possibly damaging Het
Iqgap3 GGAGAG GGAG 3: 88,112,771 probably null Het
Kat6a G A 8: 22,932,361 A896T probably benign Het
Kif28 A G 1: 179,735,994 I139T probably damaging Het
Klhl25 A G 7: 75,866,342 E332G probably damaging Het
Krt8 C T 15: 101,997,908 A389T probably benign Het
Msrb3 T C 10: 120,784,106 S175G probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo10 T C 15: 25,805,659 Y1709H probably benign Het
Nckap5 A G 1: 126,023,194 S1519P probably benign Het
Npnt T A 3: 132,909,910 D124V probably damaging Het
Nr1d1 A T 11: 98,770,836 probably null Het
Ogdh A G 11: 6,340,477 Y365C probably benign Het
Olfr1305 A T 2: 111,872,961 I298N possibly damaging Het
Prpsap1 A G 11: 116,471,438 S373P probably damaging Het
Rab28 T C 5: 41,703,534 T26A probably damaging Het
Rbbp8nl A G 2: 180,279,226 I455T probably benign Het
Rnft2 G A 5: 118,228,818 A285V possibly damaging Het
Rrp36 G T 17: 46,672,371 Q106K probably benign Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn5a A G 9: 119,486,644 L1666P probably damaging Het
Siglecf A C 7: 43,355,200 T318P probably benign Het
Slc22a1 C T 17: 12,667,305 W147* probably null Het
Smchd1 T C 17: 71,353,506 I1868V probably damaging Het
Snx21 A G 2: 164,791,902 S203G probably damaging Het
Srl T C 16: 4,482,831 K792R probably benign Het
Srrt A G 5: 137,298,673 F100S probably benign Het
Stard9 G T 2: 120,697,436 M1391I probably benign Het
Syne2 A G 12: 76,035,630 E119G probably damaging Het
Syt11 G T 3: 88,762,155 S143R possibly damaging Het
Tiparp T A 3: 65,531,642 H126Q probably benign Het
Tulp2 C A 7: 45,518,614 T150K probably benign Het
Ugt2b37 T A 5: 87,242,429 Y386F probably benign Het
Usp31 C T 7: 121,649,640 W860* probably null Het
Zfp317 A G 9: 19,643,665 R30G probably damaging Het
Zfp709 C A 8: 71,889,007 N93K possibly damaging Het
Other mutations in Phf21b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01785:Phf21b APN 15 84808061 splice site probably benign
IGL02311:Phf21b APN 15 84793894 critical splice donor site probably null
IGL02700:Phf21b APN 15 84803461 missense probably benign 0.00
IGL03201:Phf21b APN 15 84787247 missense probably benign 0.32
R0113:Phf21b UTSW 15 84804767 missense probably damaging 1.00
R1464:Phf21b UTSW 15 84804959 missense probably damaging 0.99
R1464:Phf21b UTSW 15 84804959 missense probably damaging 0.99
R1529:Phf21b UTSW 15 84797396 missense probably damaging 1.00
R1834:Phf21b UTSW 15 84797346 missense probably damaging 1.00
R1854:Phf21b UTSW 15 84854762 missense probably benign 0.41
R3683:Phf21b UTSW 15 84798690 missense probably damaging 1.00
R4729:Phf21b UTSW 15 84854741 nonsense probably null
R5476:Phf21b UTSW 15 84787265 missense probably benign
R5526:Phf21b UTSW 15 84791805 missense probably benign 0.00
R5659:Phf21b UTSW 15 84793900 nonsense probably null
R6208:Phf21b UTSW 15 84795116 missense probably damaging 0.97
R6281:Phf21b UTSW 15 84854745 missense probably benign 0.02
R6288:Phf21b UTSW 15 84855071 intron probably benign
R6322:Phf21b UTSW 15 84787379 missense possibly damaging 0.94
R7087:Phf21b UTSW 15 84791832 missense probably damaging 1.00
R7296:Phf21b UTSW 15 84855717 start codon destroyed probably null 0.77
R7331:Phf21b UTSW 15 84791094 missense probably benign 0.00
R7439:Phf21b UTSW 15 84804903 missense probably damaging 1.00
R7744:Phf21b UTSW 15 84804869 missense probably damaging 0.99
R7949:Phf21b UTSW 15 84791835 missense probably damaging 1.00
R9008:Phf21b UTSW 15 84787362 missense probably damaging 1.00
R9458:Phf21b UTSW 15 84854794 missense possibly damaging 0.89
R9468:Phf21b UTSW 15 84805098 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATGAGTGTTAGACAGGTCC -3'
(R):5'- AAGCTCTACGGGGACAGTCATC -3'

Sequencing Primer
(F):5'- CAGGTCCCTGGGGTCAGTTG -3'
(R):5'- GGACAGTCATCCCTGCCACTC -3'
Posted On 2018-10-18