Mutagenetix > Incidental Mutation

Incidental Mutation 'R6875:Krt8'

536398

Institutional Source

Beutler Lab

Gene Symbol

Krt8

Ensembl Gene

ENSMUSG00000049382

Gene Name

keratin 8

Synonyms

Krt-2.8, Krt2-8, cytokeratin 8, cytokeratin8, K8, EndoA, cytokeratin-8, Card2

MMRRC Submission

044971-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6875 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

101996698-102004482 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 101997908 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 389 (A389T)

Ref Sequence

ENSEMBL: ENSMUSP00000023952 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023952]

AlphaFold

P11679

Predicted Effect

probably benign
Transcript: ENSMUST00000023952
AA Change: A389T

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000023952
Gene: ENSMUSG00000049382
AA Change: A389T

Domain	Start	End	E-Value	Type
Pfam:Keratin_2_head	1	93	9.4e-18	PFAM
Filament	96	407	7.82e-188	SMART
low complexity region	421	438	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.2%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type II keratin family clustered on the long arm of chromosome 12. Type I and type II keratins heteropolymerize to form intermediate-sized filaments in the cytoplasm of epithelial cells. The product of this gene typically dimerizes with keratin 18 to form an intermediate filament in simple single-layered epithelial cells. This protein plays a role in maintaining cellular structural integrity and also functions in signal transduction and cellular differentiation. Mutations in this gene cause cryptogenic cirrhosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele show partial background-sensitive embryonic lethality, placental defects, impaired female fertility, abnormal hematopoiesis, diarrhea, colorectal hyperplasia, anorectal prolapse, and high liver sensitivity to toxins, apoptotic stimuli and diet-induced steatosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6030458C11Rik	T	C	15: 12,812,068	H270R	probably damaging	Het
Abcb1a	T	C	5: 8,701,628	I336T	probably benign	Het
Adam19	T	A	11: 46,112,875	F177I	probably benign	Het
Ankrd53	T	C	6: 83,768,173	V455A	probably damaging	Het
Arrdc1	A	G	2: 24,925,665	S415P	probably benign	Het
Atp10a	T	C	7: 58,797,352	L614P	probably benign	Het
C130060K24Rik	A	T	6: 65,456,336	N380I	probably benign	Het
Catsper1	G	T	19: 5,343,963	V668F	probably damaging	Het
Cluh	T	A	11: 74,661,918	D596E	probably damaging	Het
Cnot10	A	G	9: 114,615,107	S407P	probably benign	Het
Commd6	T	C	14: 101,634,350	T86A	probably damaging	Het
D5Ertd579e	A	T	5: 36,604,657		probably null	Het
Eif3l	A	G	15: 79,085,560	D252G	probably damaging	Het
Epha2	A	T	4: 141,328,468	S962C	probably damaging	Het
Fcho1	C	A	8: 71,714,425		probably null	Het
Fgf23	G	T	6: 127,073,216	G63C	probably damaging	Het
Flnc	A	T	6: 29,445,749	Y834F	probably damaging	Het
Gcn1l1	T	C	5: 115,588,110	L608P	probably damaging	Het
Hdac5	T	A	11: 102,202,276	E545V	probably damaging	Het
Hecw2	A	T	1: 53,937,132	M166K	probably benign	Het
Ikbkb	T	C	8: 22,665,893	D586G	probably damaging	Het
Il1f9	G	C	2: 24,188,621		probably null	Het
Ipo13	A	T	4: 117,904,911	I422N	possibly damaging	Het
Iqgap3	GGAGAG	GGAG	3: 88,112,771		probably null	Het
Kat6a	G	A	8: 22,932,361	A896T	probably benign	Het
Kif28	A	G	1: 179,735,994	I139T	probably damaging	Het
Klhl25	A	G	7: 75,866,342	E332G	probably damaging	Het
Msrb3	T	C	10: 120,784,106	S175G	probably benign	Het
Muc5ac	C	T	7: 141,809,744		probably benign	Het
Myo10	T	C	15: 25,805,659	Y1709H	probably benign	Het
Nckap5	A	G	1: 126,023,194	S1519P	probably benign	Het
Npnt	T	A	3: 132,909,910	D124V	probably damaging	Het
Nr1d1	A	T	11: 98,770,836		probably null	Het
Ogdh	A	G	11: 6,340,477	Y365C	probably benign	Het
Olfr1305	A	T	2: 111,872,961	I298N	possibly damaging	Het
Phf21b	A	T	15: 84,787,446	C416S	probably damaging	Het
Prpsap1	A	G	11: 116,471,438	S373P	probably damaging	Het
Rab28	T	C	5: 41,703,534	T26A	probably damaging	Het
Rbbp8nl	A	G	2: 180,279,226	I455T	probably benign	Het
Rnft2	G	A	5: 118,228,818	A285V	possibly damaging	Het
Rrp36	G	T	17: 46,672,371	Q106K	probably benign	Het
Rsf1	CG	CGACGGCGGAG	7: 97,579,908		probably benign	Het
Runx2	G	A	17: 44,814,192	P80L	probably damaging	Het
Scn5a	A	G	9: 119,486,644	L1666P	probably damaging	Het
Siglecf	A	C	7: 43,355,200	T318P	probably benign	Het
Slc22a1	C	T	17: 12,667,305	W147*	probably null	Het
Smchd1	T	C	17: 71,353,506	I1868V	probably damaging	Het
Snx21	A	G	2: 164,791,902	S203G	probably damaging	Het
Srl	T	C	16: 4,482,831	K792R	probably benign	Het
Srrt	A	G	5: 137,298,673	F100S	probably benign	Het
Stard9	G	T	2: 120,697,436	M1391I	probably benign	Het
Syne2	A	G	12: 76,035,630	E119G	probably damaging	Het
Syt11	G	T	3: 88,762,155	S143R	possibly damaging	Het
Tiparp	T	A	3: 65,531,642	H126Q	probably benign	Het
Tulp2	C	A	7: 45,518,614	T150K	probably benign	Het
Ugt2b37	T	A	5: 87,242,429	Y386F	probably benign	Het
Usp31	C	T	7: 121,649,640	W860*	probably null	Het
Zfp317	A	G	9: 19,643,665	R30G	probably damaging	Het
Zfp709	C	A	8: 71,889,007	N93K	possibly damaging	Het

Other mutations in Krt8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00508:Krt8	APN	15	101998025	missense	probably benign
IGL01643:Krt8	APN	15	101997073	missense	possibly damaging	0.64
IGL01966:Krt8	APN	15	101997670	missense	probably benign	0.08
IGL02587:Krt8	APN	15	101998932	missense	probably benign	0.04
IGL03088:Krt8	APN	15	102000587	missense	possibly damaging	0.90
R0531:Krt8	UTSW	15	102001448	missense	probably benign	0.12
R1451:Krt8	UTSW	15	101998829	missense	possibly damaging	0.93
R2258:Krt8	UTSW	15	101998822	missense	probably benign
R2348:Krt8	UTSW	15	101998865	missense	probably benign	0.31
R2566:Krt8	UTSW	15	101998024	missense	probably benign	0.03
R3796:Krt8	UTSW	15	101999442	missense	probably benign	0.00
R4834:Krt8	UTSW	15	101998821	missense	probably damaging	1.00
R4965:Krt8	UTSW	15	101996951	missense	probably benign
R5212:Krt8	UTSW	15	101997967	missense	possibly damaging	0.52
R5249:Krt8	UTSW	15	101998440	missense	possibly damaging	0.69
R5419:Krt8	UTSW	15	102003902	missense	probably damaging	0.98
R5778:Krt8	UTSW	15	102003939	missense	probably damaging	0.99
R5997:Krt8	UTSW	15	102000594	missense	possibly damaging	0.77
R6503:Krt8	UTSW	15	101997934	missense	possibly damaging	0.66
R6683:Krt8	UTSW	15	101998004	missense	probably benign
R6812:Krt8	UTSW	15	101997979	missense	probably damaging	0.99
R6824:Krt8	UTSW	15	101998440	missense	possibly damaging	0.50
R7650:Krt8	UTSW	15	102004163	missense	probably benign	0.07
R8047:Krt8	UTSW	15	102003971	missense	probably damaging	0.99
R8559:Krt8	UTSW	15	102001544	missense	probably benign	0.03
R8826:Krt8	UTSW	15	102001435	missense	possibly damaging	0.89
R9146:Krt8	UTSW	15	101998935	missense	probably damaging	0.98
R9565:Krt8	UTSW	15	102004025	missense	probably benign	0.26
Z1177:Krt8	UTSW	15	101999435	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAATGCTCATGTTCTGCATCCC -3'
(R):5'- TATGTCTCCTTCCCCACAGAGG -3'

Sequencing Primer
(F):5'- AGCCTGTAACCAGATGCGTG -3'
(R):5'- CCACAGAGGGCATCGTTG -3'

Posted On

2018-10-18