Incidental Mutation 'R6875:Srl'
ID 536399
Institutional Source Beutler Lab
Gene Symbol Srl
Ensembl Gene ENSMUSG00000022519
Gene Name sarcalumenin
Synonyms sarcalumenin, 9830004M20Rik, sar
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock # R6875 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 4480216-4541816 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 4482831 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 792 (K792R)
Ref Sequence ENSEMBL: ENSMUSP00000023161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023161] [ENSMUST00000090500]
AlphaFold Q7TQ48
Predicted Effect probably benign
Transcript: ENSMUST00000023161
AA Change: K792R

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000023161
Gene: ENSMUSG00000022519
AA Change: K792R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 111 125 N/A INTRINSIC
low complexity region 129 144 N/A INTRINSIC
low complexity region 283 300 N/A INTRINSIC
low complexity region 348 374 N/A INTRINSIC
low complexity region 379 396 N/A INTRINSIC
low complexity region 438 449 N/A INTRINSIC
Pfam:EHD_N 496 528 1.7e-13 PFAM
Pfam:MMR_HSR1 532 693 1.1e-8 PFAM
Pfam:Dynamin_N 533 694 8.6e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090500
AA Change: K354R

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000087986
Gene: ENSMUSG00000022519
AA Change: K354R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:MMR_HSR1 94 255 4e-12 PFAM
Pfam:Dynamin_N 95 256 1.2e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (58/59)
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit impaired calcium store functions in skeletal and cardiac muscle cells resulting in slow contraction and relaxation phases. Muscle also exhibits enhanced resistance to fatigue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030458C11Rik T C 15: 12,812,068 H270R probably damaging Het
Abcb1a T C 5: 8,701,628 I336T probably benign Het
Adam19 T A 11: 46,112,875 F177I probably benign Het
Ankrd53 T C 6: 83,768,173 V455A probably damaging Het
Arrdc1 A G 2: 24,925,665 S415P probably benign Het
Atp10a T C 7: 58,797,352 L614P probably benign Het
C130060K24Rik A T 6: 65,456,336 N380I probably benign Het
Catsper1 G T 19: 5,343,963 V668F probably damaging Het
Cluh T A 11: 74,661,918 D596E probably damaging Het
Cnot10 A G 9: 114,615,107 S407P probably benign Het
Commd6 T C 14: 101,634,350 T86A probably damaging Het
D5Ertd579e A T 5: 36,604,657 probably null Het
Eif3l A G 15: 79,085,560 D252G probably damaging Het
Epha2 A T 4: 141,328,468 S962C probably damaging Het
Fcho1 C A 8: 71,714,425 probably null Het
Fgf23 G T 6: 127,073,216 G63C probably damaging Het
Flnc A T 6: 29,445,749 Y834F probably damaging Het
Gcn1l1 T C 5: 115,588,110 L608P probably damaging Het
Hdac5 T A 11: 102,202,276 E545V probably damaging Het
Hecw2 A T 1: 53,937,132 M166K probably benign Het
Ikbkb T C 8: 22,665,893 D586G probably damaging Het
Il1f9 G C 2: 24,188,621 probably null Het
Ipo13 A T 4: 117,904,911 I422N possibly damaging Het
Iqgap3 GGAGAG GGAG 3: 88,112,771 probably null Het
Kat6a G A 8: 22,932,361 A896T probably benign Het
Kif28 A G 1: 179,735,994 I139T probably damaging Het
Klhl25 A G 7: 75,866,342 E332G probably damaging Het
Krt8 C T 15: 101,997,908 A389T probably benign Het
Msrb3 T C 10: 120,784,106 S175G probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo10 T C 15: 25,805,659 Y1709H probably benign Het
Nckap5 A G 1: 126,023,194 S1519P probably benign Het
Npnt T A 3: 132,909,910 D124V probably damaging Het
Nr1d1 A T 11: 98,770,836 probably null Het
Ogdh A G 11: 6,340,477 Y365C probably benign Het
Olfr1305 A T 2: 111,872,961 I298N possibly damaging Het
Phf21b A T 15: 84,787,446 C416S probably damaging Het
Prpsap1 A G 11: 116,471,438 S373P probably damaging Het
Rab28 T C 5: 41,703,534 T26A probably damaging Het
Rbbp8nl A G 2: 180,279,226 I455T probably benign Het
Rnft2 G A 5: 118,228,818 A285V possibly damaging Het
Rrp36 G T 17: 46,672,371 Q106K probably benign Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn5a A G 9: 119,486,644 L1666P probably damaging Het
Siglecf A C 7: 43,355,200 T318P probably benign Het
Slc22a1 C T 17: 12,667,305 W147* probably null Het
Smchd1 T C 17: 71,353,506 I1868V probably damaging Het
Snx21 A G 2: 164,791,902 S203G probably damaging Het
Srrt A G 5: 137,298,673 F100S probably benign Het
Stard9 G T 2: 120,697,436 M1391I probably benign Het
Syne2 A G 12: 76,035,630 E119G probably damaging Het
Syt11 G T 3: 88,762,155 S143R possibly damaging Het
Tiparp T A 3: 65,531,642 H126Q probably benign Het
Tulp2 C A 7: 45,518,614 T150K probably benign Het
Ugt2b37 T A 5: 87,242,429 Y386F probably benign Het
Usp31 C T 7: 121,649,640 W860* probably null Het
Zfp317 A G 9: 19,643,665 R30G probably damaging Het
Zfp709 C A 8: 71,889,007 N93K possibly damaging Het
Other mutations in Srl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00803:Srl APN 16 4483220 missense probably null 1.00
IGL01296:Srl APN 16 4497682 missense probably damaging 0.99
IGL02006:Srl APN 16 4497286 missense probably benign 0.23
IGL02255:Srl APN 16 4487558 missense probably damaging 1.00
IGL02583:Srl APN 16 4492380 missense possibly damaging 0.69
R0550:Srl UTSW 16 4487565 missense probably damaging 1.00
R0559:Srl UTSW 16 4496978 missense probably benign 0.01
R1933:Srl UTSW 16 4492350 missense probably damaging 0.99
R2093:Srl UTSW 16 4523032 missense unknown
R2298:Srl UTSW 16 4482898 missense probably damaging 1.00
R4093:Srl UTSW 16 4497452 missense possibly damaging 0.93
R4798:Srl UTSW 16 4492358 missense possibly damaging 0.51
R4986:Srl UTSW 16 4496782 missense probably benign 0.00
R5088:Srl UTSW 16 4482769 missense probably damaging 1.00
R5177:Srl UTSW 16 4496403 critical splice donor site probably null
R5260:Srl UTSW 16 4482895 nonsense probably null
R5988:Srl UTSW 16 4523028 missense unknown
R6946:Srl UTSW 16 4482559 missense probably benign 0.00
R7221:Srl UTSW 16 4482947 missense probably damaging 0.99
R7262:Srl UTSW 16 4497551 missense probably damaging 0.96
R8307:Srl UTSW 16 4497145 missense probably benign 0.01
R8976:Srl UTSW 16 4483030 missense probably damaging 1.00
R9193:Srl UTSW 16 4493859 missense possibly damaging 0.77
R9424:Srl UTSW 16 4483167 missense probably damaging 1.00
R9576:Srl UTSW 16 4483167 missense probably damaging 1.00
X0023:Srl UTSW 16 4492368 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTAGGAGCACTGCTGAGAG -3'
(R):5'- GGTTTACGTCAGCTCCTTCTGG -3'

Sequencing Primer
(F):5'- CTGCTGAGAGAGGAGTTTGAAATTG -3'
(R):5'- TCCTTCTGGCCACAGGACTATAAG -3'
Posted On 2018-10-18