Incidental Mutation 'R6875:Catsper1'
ID536404
Institutional Source Beutler Lab
Gene Symbol Catsper1
Ensembl Gene ENSMUSG00000038498
Gene Namecation channel, sperm associated 1
SynonymsKSper
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R6875 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location5335741-5344153 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 5343963 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 668 (V668F)
Ref Sequence ENSEMBL: ENSMUSP00000045430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025764] [ENSMUST00000043380]
Predicted Effect probably benign
Transcript: ENSMUST00000025764
SMART Domains Protein: ENSMUSP00000025764
Gene: ENSMUSG00000024846

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CY 33 147 2.36e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000043380
AA Change: V668F

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045430
Gene: ENSMUSG00000038498
AA Change: V668F

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
low complexity region 128 141 N/A INTRINSIC
low complexity region 202 225 N/A INTRINSIC
low complexity region 230 242 N/A INTRINSIC
low complexity region 290 304 N/A INTRINSIC
low complexity region 308 321 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
Pfam:Ion_trans 350 584 1.7e-34 PFAM
Pfam:PKD_channel 439 583 6.5e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcium ions play a primary role in the regulation of sperm motility. This gene belongs to a family of putative cation channels that are specific to spermatozoa and localize to the flagellum. The protein family features a single repeat with six membrane-spanning segments and a predicted calcium-selective pore region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit sperm with markedly decreased motility that are unable to fertilize ova and lack a calcium ion influx response to cyclic-AMP. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030458C11Rik T C 15: 12,812,068 H270R probably damaging Het
Abcb1a T C 5: 8,701,628 I336T probably benign Het
Adam19 T A 11: 46,112,875 F177I probably benign Het
Ankrd53 T C 6: 83,768,173 V455A probably damaging Het
Arrdc1 A G 2: 24,925,665 S415P probably benign Het
Atp10a T C 7: 58,797,352 L614P probably benign Het
C130060K24Rik A T 6: 65,456,336 N380I probably benign Het
Cluh T A 11: 74,661,918 D596E probably damaging Het
Cnot10 A G 9: 114,615,107 S407P probably benign Het
Commd6 T C 14: 101,634,350 T86A probably damaging Het
D5Ertd579e A T 5: 36,604,657 probably null Het
Eif3l A G 15: 79,085,560 D252G probably damaging Het
Epha2 A T 4: 141,328,468 S962C probably damaging Het
Fcho1 C A 8: 71,714,425 probably null Het
Fgf23 G T 6: 127,073,216 G63C probably damaging Het
Flnc A T 6: 29,445,749 Y834F probably damaging Het
Gcn1l1 T C 5: 115,588,110 L608P probably damaging Het
Hdac5 T A 11: 102,202,276 E545V probably damaging Het
Hecw2 A T 1: 53,937,132 M166K probably benign Het
Ikbkb T C 8: 22,665,893 D586G probably damaging Het
Il1f9 G C 2: 24,188,621 probably null Het
Ipo13 A T 4: 117,904,911 I422N possibly damaging Het
Iqgap3 GGAGAG GGAG 3: 88,112,771 probably null Het
Kat6a G A 8: 22,932,361 A896T probably benign Het
Kif28 A G 1: 179,735,994 I139T probably damaging Het
Klhl25 A G 7: 75,866,342 E332G probably damaging Het
Krt8 C T 15: 101,997,908 A389T probably benign Het
Msrb3 T C 10: 120,784,106 S175G probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo10 T C 15: 25,805,659 Y1709H probably benign Het
Nckap5 A G 1: 126,023,194 S1519P probably benign Het
Npnt T A 3: 132,909,910 D124V probably damaging Het
Nr1d1 A T 11: 98,770,836 probably null Het
Ogdh A G 11: 6,340,477 Y365C probably benign Het
Olfr1305 A T 2: 111,872,961 I298N possibly damaging Het
Phf21b A T 15: 84,787,446 C416S probably damaging Het
Prpsap1 A G 11: 116,471,438 S373P probably damaging Het
Rab28 T C 5: 41,703,534 T26A probably damaging Het
Rbbp8nl A G 2: 180,279,226 I455T probably benign Het
Rnft2 G A 5: 118,228,818 A285V possibly damaging Het
Rrp36 G T 17: 46,672,371 Q106K probably benign Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn5a A G 9: 119,486,644 L1666P probably damaging Het
Siglecf A C 7: 43,355,200 T318P probably benign Het
Slc22a1 C T 17: 12,667,305 W147* probably null Het
Smchd1 T C 17: 71,353,506 I1868V probably damaging Het
Snx21 A G 2: 164,791,902 S203G probably damaging Het
Srl T C 16: 4,482,831 K792R probably benign Het
Srrt A G 5: 137,298,673 F100S probably benign Het
Stard9 G T 2: 120,697,436 M1391I probably benign Het
Syne2 A G 12: 76,035,630 E119G probably damaging Het
Syt11 G T 3: 88,762,155 S143R possibly damaging Het
Tiparp T A 3: 65,531,642 H126Q probably benign Het
Tulp2 C A 7: 45,518,614 T150K probably benign Het
Ugt2b37 T A 5: 87,242,429 Y386F probably benign Het
Usp31 C T 7: 121,649,640 W860* probably null Het
Zfp317 A G 9: 19,643,665 R30G probably damaging Het
Zfp709 C A 8: 71,889,007 N93K possibly damaging Het
Other mutations in Catsper1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Catsper1 APN 19 5337772 missense probably damaging 1.00
IGL01361:Catsper1 APN 19 5339479 missense probably damaging 1.00
IGL02413:Catsper1 APN 19 5336236 missense possibly damaging 0.46
IGL02560:Catsper1 APN 19 5336188 missense possibly damaging 0.93
IGL03335:Catsper1 APN 19 5336311 missense probably damaging 0.97
R0002:Catsper1 UTSW 19 5341523 splice site probably benign
R0164:Catsper1 UTSW 19 5339475 missense possibly damaging 0.93
R0164:Catsper1 UTSW 19 5339475 missense possibly damaging 0.93
R0324:Catsper1 UTSW 19 5336545 missense probably damaging 0.99
R1782:Catsper1 UTSW 19 5335909 missense probably benign 0.01
R2301:Catsper1 UTSW 19 5340398 missense probably benign 0.41
R3864:Catsper1 UTSW 19 5336176 missense possibly damaging 0.93
R4808:Catsper1 UTSW 19 5344136 missense possibly damaging 0.76
R4941:Catsper1 UTSW 19 5341438 missense possibly damaging 0.90
R4983:Catsper1 UTSW 19 5335963 missense probably benign 0.26
R5072:Catsper1 UTSW 19 5340046 unclassified probably null
R5077:Catsper1 UTSW 19 5335970 missense probably damaging 0.99
R5629:Catsper1 UTSW 19 5336137 missense probably benign 0.00
R6402:Catsper1 UTSW 19 5339496 missense probably damaging 1.00
R7368:Catsper1 UTSW 19 5336663 missense unknown
R7510:Catsper1 UTSW 19 5339550 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- AGACATACTGGAGATAGACACCTC -3'
(R):5'- AGGTAGCTTGCCAGAAACTC -3'

Sequencing Primer
(F):5'- CTGGAGATAGACACCTCGTTCATG -3'
(R):5'- TAGCTTGCCAGAAACTCAGGTTAG -3'
Posted On2018-10-18