Incidental Mutation 'R6876:Gimap3'
ID536411
Institutional Source Beutler Lab
Gene Symbol Gimap3
Ensembl Gene ENSMUSG00000039264
Gene NameGTPase, IMAP family member 3
SynonymsIan4, 2010110D23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6876 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location48764464-48770851 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48765921 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 25 (I25N)
Ref Sequence ENSEMBL: ENSMUSP00000145211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038811] [ENSMUST00000204036]
Predicted Effect probably damaging
Transcript: ENSMUST00000038811
AA Change: I25N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047435
Gene: ENSMUSG00000039264
AA Change: I25N

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
Pfam:AIG1 23 234 1.5e-79 PFAM
Pfam:MMR_HSR1 24 147 5.3e-8 PFAM
transmembrane domain 280 299 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000204036
AA Change: I25N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145211
Gene: ENSMUSG00000039264
AA Change: I25N

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
Pfam:AIG1 23 234 1.5e-79 PFAM
Pfam:MMR_HSR1 24 147 5.3e-8 PFAM
transmembrane domain 280 299 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a mitochondrial membrane protein belonging to the GTP-binding superfamily and to the immuno-associated nucleotide (IAN) subfamily of nucleotide-binding proteins. The expression of this gene is induced in BCR/ABL-expressing cells. The encoded protein lacks an N-terminal mitochondrial signal sequence. Experimental studies showed that mitochondrial localization relies on the C-terminal transmembrane domain. In humans, the IAN subfamily genes are located in a cluster at 7q36.1 [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T C 13: 58,385,096 D20G probably damaging Het
Aasdh T C 5: 76,896,441 T201A probably damaging Het
Abca12 T A 1: 71,263,508 D2184V probably damaging Het
Abcf1 C T 17: 35,959,244 D641N probably benign Het
Adgrv1 C A 13: 81,155,154 probably null Het
Aftph T C 11: 20,709,744 E693G probably damaging Het
Ahnak A G 19: 9,014,120 D4256G probably damaging Het
Arv1 A G 8: 124,730,912 K185R probably damaging Het
Ces4a T A 8: 105,144,992 V258D possibly damaging Het
Col6a5 T C 9: 105,937,307 D502G unknown Het
Diaph1 A T 18: 37,896,373 H335Q unknown Het
Dtna G A 18: 23,611,110 V404I probably benign Het
Ephb1 T C 9: 101,984,120 D615G probably damaging Het
Hao1 A G 2: 134,501,149 V274A probably benign Het
Hirip3 T C 7: 126,864,149 S426P probably damaging Het
Igkv4-69 T C 6: 69,283,834 D103G probably damaging Het
Kdm8 T C 7: 125,452,658 V141A probably benign Het
Mink1 G T 11: 70,607,435 A553S probably benign Het
Mpl T A 4: 118,457,120 Y60F probably damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo5a C A 9: 75,160,490 R609S probably benign Het
Myo5b A T 18: 74,707,955 H969L probably benign Het
Olfr1388 T C 11: 49,444,241 L130P probably damaging Het
Olfr354 T A 2: 36,907,822 I292N probably damaging Het
Olfr92 G C 17: 37,111,206 Q259E probably damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Prodh2 T A 7: 30,506,500 W207R probably damaging Het
Rfx6 A G 10: 51,719,991 K457E probably damaging Het
Sim1 A G 10: 50,983,695 E551G possibly damaging Het
Soat2 T C 15: 102,160,614 F358S probably damaging Het
Tes3-ps A G 13: 49,493,719 K24E probably benign Het
Txndc16 A G 14: 45,163,040 F335L possibly damaging Het
Unc45b T C 11: 82,922,912 Y382H probably benign Het
Vmn2r60 A G 7: 42,135,663 T100A probably null Het
Vmn2r93 T A 17: 18,305,188 H369Q probably benign Het
Yy1 A G 12: 108,806,592 I265V probably benign Het
Zfp54 A T 17: 21,433,977 K244N probably damaging Het
Other mutations in Gimap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01763:Gimap3 APN 6 48765496 missense probably damaging 1.00
IGL02141:Gimap3 APN 6 48765378 missense probably benign 0.42
IGL02751:Gimap3 APN 6 48765238 missense probably benign
R0333:Gimap3 UTSW 6 48765730 nonsense probably null
R1081:Gimap3 UTSW 6 48765152 nonsense probably null
R1911:Gimap3 UTSW 6 48765712 missense possibly damaging 0.80
R1936:Gimap3 UTSW 6 48765749 missense probably damaging 1.00
R2990:Gimap3 UTSW 6 48765851 missense probably damaging 0.98
R4052:Gimap3 UTSW 6 48766513 missense possibly damaging 0.53
R4433:Gimap3 UTSW 6 48765946 missense possibly damaging 0.53
R4571:Gimap3 UTSW 6 48765720 missense possibly damaging 0.74
R4672:Gimap3 UTSW 6 48765753 missense probably damaging 0.99
R4709:Gimap3 UTSW 6 48765393 missense probably benign 0.02
R5094:Gimap3 UTSW 6 48765372 missense probably damaging 1.00
R5510:Gimap3 UTSW 6 48765249 missense possibly damaging 0.93
R7359:Gimap3 UTSW 6 48765346 missense probably benign 0.26
R7923:Gimap3 UTSW 6 48765627 missense probably benign 0.33
R8322:Gimap3 UTSW 6 48765436 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGCAGTCTCCGATGTCCTTG -3'
(R):5'- TTGATCCCAGAAGTCCCCTGTG -3'

Sequencing Primer
(F):5'- CCATGTCTTGGTTCTGGGCC -3'
(R):5'- CAGAAGTCCCCTGTGTGATG -3'
Posted On2018-10-18