Incidental Mutation 'R6876:Prodh2'
ID536413
Institutional Source Beutler Lab
Gene Symbol Prodh2
Ensembl Gene ENSMUSG00000036892
Gene Nameproline dehydrogenase (oxidase) 2
Synonyms2510028N04Rik, POX1, 2510038B11Rik, MmPOX1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R6876 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location30493622-30513402 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30506500 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 207 (W207R)
Ref Sequence ENSEMBL: ENSMUSP00000116662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058280] [ENSMUST00000130839] [ENSMUST00000131040] [ENSMUST00000133318] [ENSMUST00000142575]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058280
AA Change: W268R

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000062214
Gene: ENSMUSG00000036892
AA Change: W268R

DomainStartEndE-ValueType
low complexity region 37 46 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
Pfam:Pro_dh 87 440 3.4e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122876
SMART Domains Protein: ENSMUSP00000114278
Gene: ENSMUSG00000036892

DomainStartEndE-ValueType
Pfam:Pro_dh 1 82 2.2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130839
SMART Domains Protein: ENSMUSP00000117480
Gene: ENSMUSG00000036892

DomainStartEndE-ValueType
low complexity region 37 46 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
low complexity region 97 112 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000131040
AA Change: W207R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116662
Gene: ENSMUSG00000036892
AA Change: W207R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 33 47 N/A INTRINSIC
low complexity region 65 80 N/A INTRINSIC
Pfam:Pro_dh 91 260 5e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133318
SMART Domains Protein: ENSMUSP00000122546
Gene: ENSMUSG00000036892

DomainStartEndE-ValueType
low complexity region 37 46 N/A INTRINSIC
low complexity region 63 77 N/A INTRINSIC
low complexity region 95 110 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000142575
AA Change: W254R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114778
Gene: ENSMUSG00000036892
AA Change: W254R

DomainStartEndE-ValueType
low complexity region 57 68 N/A INTRINSIC
Pfam:Pro_dh 147 284 6.5e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the first step in the catabolism of trans-4-hydroxy-L-proline, an amino acid derivative obtained through food intake and collagen turnover. One of the downstream products of this catabolism is glyoxylate, which in people with disorders of glyoxalate metabolism can lead to an increase in oxalate levels and the formation of calcium-oxalate kidney stones. Therefore, this gene may serve as a therapeutic target against primary hyperoxalurias (PH). This gene is similar to proline dehydrogenase (oxidase) 1, a mitochondrial enzyme that catalyzes the first step in proline catabolism. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T C 13: 58,385,096 D20G probably damaging Het
Aasdh T C 5: 76,896,441 T201A probably damaging Het
Abca12 T A 1: 71,263,508 D2184V probably damaging Het
Abcf1 C T 17: 35,959,244 D641N probably benign Het
Adgrv1 C A 13: 81,155,154 probably null Het
Aftph T C 11: 20,709,744 E693G probably damaging Het
Ahnak A G 19: 9,014,120 D4256G probably damaging Het
Arv1 A G 8: 124,730,912 K185R probably damaging Het
Ces4a T A 8: 105,144,992 V258D possibly damaging Het
Col6a5 T C 9: 105,937,307 D502G unknown Het
Diaph1 A T 18: 37,896,373 H335Q unknown Het
Dtna G A 18: 23,611,110 V404I probably benign Het
Ephb1 T C 9: 101,984,120 D615G probably damaging Het
Gimap3 A T 6: 48,765,921 I25N probably damaging Het
Hao1 A G 2: 134,501,149 V274A probably benign Het
Hirip3 T C 7: 126,864,149 S426P probably damaging Het
Igkv4-69 T C 6: 69,283,834 D103G probably damaging Het
Kdm8 T C 7: 125,452,658 V141A probably benign Het
Mink1 G T 11: 70,607,435 A553S probably benign Het
Mpl T A 4: 118,457,120 Y60F probably damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo5a C A 9: 75,160,490 R609S probably benign Het
Myo5b A T 18: 74,707,955 H969L probably benign Het
Olfr1388 T C 11: 49,444,241 L130P probably damaging Het
Olfr354 T A 2: 36,907,822 I292N probably damaging Het
Olfr92 G C 17: 37,111,206 Q259E probably damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Rfx6 A G 10: 51,719,991 K457E probably damaging Het
Sim1 A G 10: 50,983,695 E551G possibly damaging Het
Soat2 T C 15: 102,160,614 F358S probably damaging Het
Tes3-ps A G 13: 49,493,719 K24E probably benign Het
Txndc16 A G 14: 45,163,040 F335L possibly damaging Het
Unc45b T C 11: 82,922,912 Y382H probably benign Het
Vmn2r60 A G 7: 42,135,663 T100A probably null Het
Vmn2r93 T A 17: 18,305,188 H369Q probably benign Het
Yy1 A G 12: 108,806,592 I265V probably benign Het
Zfp54 A T 17: 21,433,977 K244N probably damaging Het
Other mutations in Prodh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01720:Prodh2 APN 7 30511203 missense probably damaging 1.00
IGL01949:Prodh2 APN 7 30509765 critical splice acceptor site probably null
IGL02119:Prodh2 APN 7 30506504 missense probably damaging 1.00
IGL02334:Prodh2 APN 7 30506378 missense probably damaging 0.99
IGL03061:Prodh2 APN 7 30512833 nonsense probably null
R0831:Prodh2 UTSW 7 30494224 nonsense probably null
R0964:Prodh2 UTSW 7 30506281 missense probably damaging 1.00
R1295:Prodh2 UTSW 7 30494089 missense probably damaging 1.00
R4414:Prodh2 UTSW 7 30506452 missense probably damaging 1.00
R5035:Prodh2 UTSW 7 30506479 missense possibly damaging 0.49
R5461:Prodh2 UTSW 7 30494523 missense possibly damaging 0.92
R5643:Prodh2 UTSW 7 30506746 missense possibly damaging 0.65
R6276:Prodh2 UTSW 7 30506651 missense probably benign 0.07
R8040:Prodh2 UTSW 7 30506411 missense probably damaging 1.00
X0026:Prodh2 UTSW 7 30493775 missense possibly damaging 0.83
Z1177:Prodh2 UTSW 7 30493990 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAACACATGGGCATCCTGG -3'
(R):5'- TCCTTGTCCAGATAGGCACC -3'

Sequencing Primer
(F):5'- ATGGGCATCCTGGCTCCC -3'
(R):5'- GTCCAGATAGGCACCTCGCAC -3'
Posted On2018-10-18