Incidental Mutation 'R6876:Kdm8'
ID536415
Institutional Source Beutler Lab
Gene Symbol Kdm8
Ensembl Gene ENSMUSG00000030752
Gene Namelysine (K)-specific demethylase 8
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6876 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location125444676-125462269 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125452658 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 141 (V141A)
Ref Sequence ENSEMBL: ENSMUSP00000033010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033010] [ENSMUST00000135129]
Predicted Effect probably benign
Transcript: ENSMUST00000033010
AA Change: V141A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000033010
Gene: ENSMUSG00000030752
AA Change: V141A

DomainStartEndE-ValueType
low complexity region 22 39 N/A INTRINSIC
JmjC 269 414 2.71e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135129
SMART Domains Protein: ENSMUSP00000114890
Gene: ENSMUSG00000030752

DomainStartEndE-ValueType
Pfam:Cupin_8 13 152 1.4e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene likely encodes a histone lysine demethylase. Studies of a similar protein in mouse indicate a potential role for this protein as a tumor suppressor. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygous inactivation of this gene leads to complete embryonic lethality during organogenesis associated with severe growth retardation and abnormal embryo turning. Observed phenotypes include open neural tubes and absent vitelline blood vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T C 13: 58,385,096 D20G probably damaging Het
Aasdh T C 5: 76,896,441 T201A probably damaging Het
Abca12 T A 1: 71,263,508 D2184V probably damaging Het
Abcf1 C T 17: 35,959,244 D641N probably benign Het
Adgrv1 C A 13: 81,155,154 probably null Het
Aftph T C 11: 20,709,744 E693G probably damaging Het
Ahnak A G 19: 9,014,120 D4256G probably damaging Het
Arv1 A G 8: 124,730,912 K185R probably damaging Het
Ces4a T A 8: 105,144,992 V258D possibly damaging Het
Col6a5 T C 9: 105,937,307 D502G unknown Het
Diaph1 A T 18: 37,896,373 H335Q unknown Het
Dtna G A 18: 23,611,110 V404I probably benign Het
Ephb1 T C 9: 101,984,120 D615G probably damaging Het
Gimap3 A T 6: 48,765,921 I25N probably damaging Het
Hao1 A G 2: 134,501,149 V274A probably benign Het
Hirip3 T C 7: 126,864,149 S426P probably damaging Het
Igkv4-69 T C 6: 69,283,834 D103G probably damaging Het
Mink1 G T 11: 70,607,435 A553S probably benign Het
Mpl T A 4: 118,457,120 Y60F probably damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo5a C A 9: 75,160,490 R609S probably benign Het
Myo5b A T 18: 74,707,955 H969L probably benign Het
Olfr1388 T C 11: 49,444,241 L130P probably damaging Het
Olfr354 T A 2: 36,907,822 I292N probably damaging Het
Olfr92 G C 17: 37,111,206 Q259E probably damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Prodh2 T A 7: 30,506,500 W207R probably damaging Het
Rfx6 A G 10: 51,719,991 K457E probably damaging Het
Sim1 A G 10: 50,983,695 E551G possibly damaging Het
Soat2 T C 15: 102,160,614 F358S probably damaging Het
Tes3-ps A G 13: 49,493,719 K24E probably benign Het
Txndc16 A G 14: 45,163,040 F335L possibly damaging Het
Unc45b T C 11: 82,922,912 Y382H probably benign Het
Vmn2r60 A G 7: 42,135,663 T100A probably null Het
Vmn2r93 T A 17: 18,305,188 H369Q probably benign Het
Yy1 A G 12: 108,806,592 I265V probably benign Het
Zfp54 A T 17: 21,433,977 K244N probably damaging Het
Other mutations in Kdm8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Kdm8 APN 7 125461205 missense probably damaging 1.00
IGL01975:Kdm8 APN 7 125452357 missense probably benign 0.04
IGL02019:Kdm8 APN 7 125452486 missense probably damaging 0.98
IGL03387:Kdm8 APN 7 125455106 missense probably benign 0.00
R0321:Kdm8 UTSW 7 125461006 missense probably damaging 1.00
R0479:Kdm8 UTSW 7 125452640 missense probably damaging 1.00
R1995:Kdm8 UTSW 7 125452339 missense probably benign 0.00
R4058:Kdm8 UTSW 7 125456494 missense probably damaging 1.00
R4760:Kdm8 UTSW 7 125455259 critical splice donor site probably null
R5683:Kdm8 UTSW 7 125455173 missense possibly damaging 0.93
R7189:Kdm8 UTSW 7 125460931 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTAGACTACTCCTGGGAAAAG -3'
(R):5'- GCTCTTTTCACCAGAGAGGC -3'

Sequencing Primer
(F):5'- CTGGTCCCTGGAGAGATGTAGAC -3'
(R):5'- TTTTCACCAGAGAGGCTGCCTG -3'
Posted On2018-10-18