Incidental Mutation 'R6876:Arv1'
ID536419
Institutional Source Beutler Lab
Gene Symbol Arv1
Ensembl Gene ENSMUSG00000031982
Gene NameARV1 homolog, fatty acid homeostasis modulator
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock #R6876 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location124722139-124734123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124730912 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 185 (K185R)
Ref Sequence ENSEMBL: ENSMUSP00000034463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034463] [ENSMUST00000212036]
Predicted Effect probably damaging
Transcript: ENSMUST00000034463
AA Change: K185R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034463
Gene: ENSMUSG00000031982
AA Change: K185R

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:Arv1 28 218 8.4e-68 PFAM
transmembrane domain 228 247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212036
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] this gene encodes a transmembrane protein that contains a conserved zinc ribbon motif at the N- terminus. A similar protein in mouse is thought to function in fatty acid homeostasis. Mutations in this gene are associated with early infantile epileptic encephalopathy 38. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous KO causes female infertility, reduction in body weight, amount of white adipose tissue and plasma lipid levels and increase in adiponectin levels, food consumption, energy expenditure and activity levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T C 13: 58,385,096 D20G probably damaging Het
Aasdh T C 5: 76,896,441 T201A probably damaging Het
Abca12 T A 1: 71,263,508 D2184V probably damaging Het
Abcf1 C T 17: 35,959,244 D641N probably benign Het
Adgrv1 C A 13: 81,155,154 probably null Het
Aftph T C 11: 20,709,744 E693G probably damaging Het
Ahnak A G 19: 9,014,120 D4256G probably damaging Het
Ces4a T A 8: 105,144,992 V258D possibly damaging Het
Col6a5 T C 9: 105,937,307 D502G unknown Het
Diaph1 A T 18: 37,896,373 H335Q unknown Het
Dtna G A 18: 23,611,110 V404I probably benign Het
Ephb1 T C 9: 101,984,120 D615G probably damaging Het
Gimap3 A T 6: 48,765,921 I25N probably damaging Het
Hao1 A G 2: 134,501,149 V274A probably benign Het
Hirip3 T C 7: 126,864,149 S426P probably damaging Het
Igkv4-69 T C 6: 69,283,834 D103G probably damaging Het
Kdm8 T C 7: 125,452,658 V141A probably benign Het
Mink1 G T 11: 70,607,435 A553S probably benign Het
Mpl T A 4: 118,457,120 Y60F probably damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo5a C A 9: 75,160,490 R609S probably benign Het
Myo5b A T 18: 74,707,955 H969L probably benign Het
Olfr1388 T C 11: 49,444,241 L130P probably damaging Het
Olfr354 T A 2: 36,907,822 I292N probably damaging Het
Olfr92 G C 17: 37,111,206 Q259E probably damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Prodh2 T A 7: 30,506,500 W207R probably damaging Het
Rfx6 A G 10: 51,719,991 K457E probably damaging Het
Sim1 A G 10: 50,983,695 E551G possibly damaging Het
Soat2 T C 15: 102,160,614 F358S probably damaging Het
Tes3-ps A G 13: 49,493,719 K24E probably benign Het
Txndc16 A G 14: 45,163,040 F335L possibly damaging Het
Unc45b T C 11: 82,922,912 Y382H probably benign Het
Vmn2r60 A G 7: 42,135,663 T100A probably null Het
Vmn2r93 T A 17: 18,305,188 H369Q probably benign Het
Yy1 A G 12: 108,806,592 I265V probably benign Het
Zfp54 A T 17: 21,433,977 K244N probably damaging Het
Other mutations in Arv1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02093:Arv1 APN 8 124730878 missense probably damaging 1.00
R1054:Arv1 UTSW 8 124731872 missense probably benign
R1725:Arv1 UTSW 8 124728452 missense probably damaging 1.00
R2171:Arv1 UTSW 8 124728355 missense probably damaging 1.00
R8298:Arv1 UTSW 8 124728372 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTTCTTAGGACAGCAGCTGC -3'
(R):5'- TCACCAAGTCTGATGCCCTG -3'

Sequencing Primer
(F):5'- GCAGCTGCGTTCTGTGC -3'
(R):5'- TGGGGCCATCATGTCAAGG -3'
Posted On2018-10-18