Incidental Mutation 'R6876:Rfx6'
ID536424
Institutional Source Beutler Lab
Gene Symbol Rfx6
Ensembl Gene ENSMUSG00000019900
Gene Nameregulatory factor X, 6
SynonymsRfxdc1, 4930572O07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6876 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location51677756-51730432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51719991 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 457 (K457E)
Ref Sequence ENSEMBL: ENSMUSP00000116057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050455] [ENSMUST00000122922] [ENSMUST00000219364]
Predicted Effect probably damaging
Transcript: ENSMUST00000050455
AA Change: K193E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000057384
Gene: ENSMUSG00000019900
AA Change: K193E

DomainStartEndE-ValueType
Blast:HisKA 91 153 1e-7 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000122922
AA Change: K457E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116057
Gene: ENSMUSG00000019900
AA Change: K457E

DomainStartEndE-ValueType
Pfam:RFX_DNA_binding 120 198 1.9e-33 PFAM
Blast:HisKA 355 417 2e-7 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000219364
AA Change: K423E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000219771
AA Change: K244E

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear protein encoded by this gene is a member of the regulatory factor X (RFX) family of transcription factors. Studies in mice suggest that this gene is specifically required for the differentiation of islet cells for the production of insulin, but not for the differentiation of pancreatic polypeptide-producing cells. It regulates the transcription factors involved in beta-cell maturation and function, thus, restricting the expression of the beta-cell differentiation and specification genes. Mutations in this gene are associated with Mitchell-Riley syndrome, which is characterized by neonatal diabetes with pancreatic hypoplasia, duodenal and jejunal atresia, and gall bladder agenesis.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes fail to feed normally, show small bowel obstruction and die within 2 days of birth. Mutants fail to generate any of the normal islet cell types except for pancreatic-polypeptide-producing cells. Some display a reduced pancreas size; however, primary cilia formation in islets is normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T C 13: 58,385,096 D20G probably damaging Het
Aasdh T C 5: 76,896,441 T201A probably damaging Het
Abca12 T A 1: 71,263,508 D2184V probably damaging Het
Abcf1 C T 17: 35,959,244 D641N probably benign Het
Adgrv1 C A 13: 81,155,154 probably null Het
Aftph T C 11: 20,709,744 E693G probably damaging Het
Ahnak A G 19: 9,014,120 D4256G probably damaging Het
Arv1 A G 8: 124,730,912 K185R probably damaging Het
Ces4a T A 8: 105,144,992 V258D possibly damaging Het
Col6a5 T C 9: 105,937,307 D502G unknown Het
Diaph1 A T 18: 37,896,373 H335Q unknown Het
Dtna G A 18: 23,611,110 V404I probably benign Het
Ephb1 T C 9: 101,984,120 D615G probably damaging Het
Gimap3 A T 6: 48,765,921 I25N probably damaging Het
Hao1 A G 2: 134,501,149 V274A probably benign Het
Hirip3 T C 7: 126,864,149 S426P probably damaging Het
Igkv4-69 T C 6: 69,283,834 D103G probably damaging Het
Kdm8 T C 7: 125,452,658 V141A probably benign Het
Mink1 G T 11: 70,607,435 A553S probably benign Het
Mpl T A 4: 118,457,120 Y60F probably damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo5a C A 9: 75,160,490 R609S probably benign Het
Myo5b A T 18: 74,707,955 H969L probably benign Het
Olfr1388 T C 11: 49,444,241 L130P probably damaging Het
Olfr354 T A 2: 36,907,822 I292N probably damaging Het
Olfr92 G C 17: 37,111,206 Q259E probably damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Prodh2 T A 7: 30,506,500 W207R probably damaging Het
Sim1 A G 10: 50,983,695 E551G possibly damaging Het
Soat2 T C 15: 102,160,614 F358S probably damaging Het
Tes3-ps A G 13: 49,493,719 K24E probably benign Het
Txndc16 A G 14: 45,163,040 F335L possibly damaging Het
Unc45b T C 11: 82,922,912 Y382H probably benign Het
Vmn2r60 A G 7: 42,135,663 T100A probably null Het
Vmn2r93 T A 17: 18,305,188 H369Q probably benign Het
Yy1 A G 12: 108,806,592 I265V probably benign Het
Zfp54 A T 17: 21,433,977 K244N probably damaging Het
Other mutations in Rfx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Rfx6 APN 10 51681886 missense probably damaging 1.00
IGL00816:Rfx6 APN 10 51678405 missense probably benign 0.16
IGL01639:Rfx6 APN 10 51715906 nonsense probably null
IGL01721:Rfx6 APN 10 51723077 missense probably damaging 1.00
IGL01861:Rfx6 APN 10 51721579 missense probably damaging 1.00
IGL02103:Rfx6 APN 10 51726856 missense possibly damaging 0.93
IGL02113:Rfx6 APN 10 51678012 missense probably benign
IGL02479:Rfx6 APN 10 51678328 missense probably benign 0.07
IGL02592:Rfx6 APN 10 51716023 missense probably damaging 1.00
IGL02635:Rfx6 APN 10 51716026 missense possibly damaging 0.80
IGL02891:Rfx6 APN 10 51723846 missense possibly damaging 0.64
IGL03153:Rfx6 APN 10 51723121 nonsense probably null
IGL03263:Rfx6 APN 10 51725807 missense probably benign 0.00
IGL03373:Rfx6 APN 10 51720000 missense probably damaging 0.99
bulky UTSW 10 51678333 missense probably benign 0.00
R0060:Rfx6 UTSW 10 51677840 missense probably benign 0.00
R0433:Rfx6 UTSW 10 51720028 missense probably damaging 1.00
R1329:Rfx6 UTSW 10 51693737 missense probably damaging 1.00
R1709:Rfx6 UTSW 10 51678402 missense possibly damaging 0.64
R1820:Rfx6 UTSW 10 51723125 critical splice donor site probably null
R2017:Rfx6 UTSW 10 51721604 missense possibly damaging 0.50
R2020:Rfx6 UTSW 10 51720057 critical splice donor site probably null
R2044:Rfx6 UTSW 10 51718126 missense probably benign 0.16
R2495:Rfx6 UTSW 10 51726675 splice site probably benign
R2655:Rfx6 UTSW 10 51693777 splice site probably benign
R2912:Rfx6 UTSW 10 51718130 missense probably damaging 1.00
R3159:Rfx6 UTSW 10 51726720 missense probably damaging 1.00
R4036:Rfx6 UTSW 10 51726746 missense probably damaging 1.00
R4536:Rfx6 UTSW 10 51723784 missense probably benign 0.16
R4791:Rfx6 UTSW 10 51719944 splice site probably null
R4945:Rfx6 UTSW 10 51726851 nonsense probably null
R5223:Rfx6 UTSW 10 51677996 nonsense probably null
R5233:Rfx6 UTSW 10 51712091 nonsense probably null
R5448:Rfx6 UTSW 10 51683637 missense probably damaging 1.00
R5600:Rfx6 UTSW 10 51723061 missense probably damaging 1.00
R5768:Rfx6 UTSW 10 51726880 missense probably damaging 0.99
R5858:Rfx6 UTSW 10 51725868 missense probably benign 0.00
R5949:Rfx6 UTSW 10 51678333 missense probably benign 0.00
R6001:Rfx6 UTSW 10 51718211 splice site probably null
R6003:Rfx6 UTSW 10 51708587 missense probably damaging 1.00
R6118:Rfx6 UTSW 10 51711866 missense possibly damaging 0.91
R6629:Rfx6 UTSW 10 51725490 missense probably benign 0.02
R6894:Rfx6 UTSW 10 51716039 missense probably damaging 1.00
R6912:Rfx6 UTSW 10 51723853 missense probably benign 0.00
R7130:Rfx6 UTSW 10 51678380 nonsense probably null
R7574:Rfx6 UTSW 10 51681818 missense probably benign 0.17
R7845:Rfx6 UTSW 10 51678026 missense probably benign 0.05
R8188:Rfx6 UTSW 10 51718196 missense probably benign 0.05
R8338:Rfx6 UTSW 10 51718094 missense probably damaging 0.96
R8710:Rfx6 UTSW 10 51725405 missense probably damaging 1.00
R8716:Rfx6 UTSW 10 51681872 missense probably damaging 1.00
V8831:Rfx6 UTSW 10 51718208 critical splice donor site probably null
X0023:Rfx6 UTSW 10 51678411 missense probably damaging 1.00
Z1176:Rfx6 UTSW 10 51718093 missense probably benign 0.05
Z1176:Rfx6 UTSW 10 51725831 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTCAAGGATATATCTTGGGTTCAAAG -3'
(R):5'- CCAGGACCTTGTATGAGGAAGAAC -3'

Sequencing Primer
(F):5'- AATCCCACTGATACACTTCCTC -3'
(R):5'- GACTGTTGATAGCCATCCAGGTC -3'
Posted On2018-10-18