Incidental Mutation 'R6876:Aftph'
ID536425
Institutional Source Beutler Lab
Gene Symbol Aftph
Ensembl Gene ENSMUSG00000049659
Gene Nameaftiphilin
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.758) question?
Stock #R6876 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location20685084-20741589 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20709744 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 693 (E693G)
Ref Sequence ENSEMBL: ENSMUSP00000121612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035350] [ENSMUST00000146722] [ENSMUST00000177014] [ENSMUST00000177543]
Predicted Effect probably damaging
Transcript: ENSMUST00000035350
AA Change: E693G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000036778
Gene: ENSMUSG00000049659
AA Change: E693G

DomainStartEndE-ValueType
low complexity region 19 45 N/A INTRINSIC
low complexity region 546 560 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
Pfam:Clathrin_bdg 693 765 1.1e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000146722
AA Change: E693G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121612
Gene: ENSMUSG00000049659
AA Change: E693G

DomainStartEndE-ValueType
low complexity region 19 45 N/A INTRINSIC
low complexity region 546 560 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
Pfam:Clathrin_bdg 694 765 1.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176782
SMART Domains Protein: ENSMUSP00000134791
Gene: ENSMUSG00000049659

DomainStartEndE-ValueType
low complexity region 68 82 N/A INTRINSIC
low complexity region 140 153 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177014
AA Change: E538G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135450
Gene: ENSMUSG00000049659
AA Change: E538G

DomainStartEndE-ValueType
low complexity region 391 405 N/A INTRINSIC
low complexity region 463 476 N/A INTRINSIC
Pfam:Clathrin_bdg 538 610 6.8e-37 PFAM
low complexity region 664 677 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000177543
AA Change: E693G

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134991
Gene: ENSMUSG00000049659
AA Change: E693G

DomainStartEndE-ValueType
low complexity region 19 45 N/A INTRINSIC
low complexity region 546 560 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
Pfam:Clathrin_bdg 693 765 8.7e-37 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T C 13: 58,385,096 D20G probably damaging Het
Aasdh T C 5: 76,896,441 T201A probably damaging Het
Abca12 T A 1: 71,263,508 D2184V probably damaging Het
Abcf1 C T 17: 35,959,244 D641N probably benign Het
Adgrv1 C A 13: 81,155,154 probably null Het
Ahnak A G 19: 9,014,120 D4256G probably damaging Het
Arv1 A G 8: 124,730,912 K185R probably damaging Het
Ces4a T A 8: 105,144,992 V258D possibly damaging Het
Col6a5 T C 9: 105,937,307 D502G unknown Het
Diaph1 A T 18: 37,896,373 H335Q unknown Het
Dtna G A 18: 23,611,110 V404I probably benign Het
Ephb1 T C 9: 101,984,120 D615G probably damaging Het
Gimap3 A T 6: 48,765,921 I25N probably damaging Het
Hao1 A G 2: 134,501,149 V274A probably benign Het
Hirip3 T C 7: 126,864,149 S426P probably damaging Het
Igkv4-69 T C 6: 69,283,834 D103G probably damaging Het
Kdm8 T C 7: 125,452,658 V141A probably benign Het
Mink1 G T 11: 70,607,435 A553S probably benign Het
Mpl T A 4: 118,457,120 Y60F probably damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo5a C A 9: 75,160,490 R609S probably benign Het
Myo5b A T 18: 74,707,955 H969L probably benign Het
Olfr1388 T C 11: 49,444,241 L130P probably damaging Het
Olfr354 T A 2: 36,907,822 I292N probably damaging Het
Olfr92 G C 17: 37,111,206 Q259E probably damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Prodh2 T A 7: 30,506,500 W207R probably damaging Het
Rfx6 A G 10: 51,719,991 K457E probably damaging Het
Sim1 A G 10: 50,983,695 E551G possibly damaging Het
Soat2 T C 15: 102,160,614 F358S probably damaging Het
Tes3-ps A G 13: 49,493,719 K24E probably benign Het
Txndc16 A G 14: 45,163,040 F335L possibly damaging Het
Unc45b T C 11: 82,922,912 Y382H probably benign Het
Vmn2r60 A G 7: 42,135,663 T100A probably null Het
Vmn2r93 T A 17: 18,305,188 H369Q probably benign Het
Yy1 A G 12: 108,806,592 I265V probably benign Het
Zfp54 A T 17: 21,433,977 K244N probably damaging Het
Other mutations in Aftph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Aftph APN 11 20727483 missense probably damaging 1.00
IGL01485:Aftph APN 11 20692507 missense probably damaging 1.00
IGL01622:Aftph APN 11 20709632 missense probably damaging 1.00
IGL01623:Aftph APN 11 20709632 missense probably damaging 1.00
IGL01739:Aftph APN 11 20726994 missense probably damaging 0.98
IGL01777:Aftph APN 11 20726554 missense possibly damaging 0.49
IGL01825:Aftph APN 11 20726569 missense possibly damaging 0.77
IGL02804:Aftph APN 11 20726107 missense possibly damaging 0.89
IGL03003:Aftph APN 11 20726982 nonsense probably null
IGL03111:Aftph APN 11 20726040 missense probably benign 0.44
R1103:Aftph UTSW 11 20726547 missense probably benign 0.00
R1672:Aftph UTSW 11 20726762 missense probably benign 0.10
R2060:Aftph UTSW 11 20692571 missense probably damaging 1.00
R2141:Aftph UTSW 11 20698318 nonsense probably null
R2241:Aftph UTSW 11 20726328 missense possibly damaging 0.90
R2513:Aftph UTSW 11 20708676 splice site probably null
R2518:Aftph UTSW 11 20725797 missense probably damaging 0.98
R4751:Aftph UTSW 11 20727074 missense probably damaging 1.00
R4844:Aftph UTSW 11 20708667 splice site probably benign
R4879:Aftph UTSW 11 20698311 critical splice donor site probably null
R4895:Aftph UTSW 11 20696801 missense probably damaging 1.00
R5012:Aftph UTSW 11 20698264 intron probably benign
R5082:Aftph UTSW 11 20727100 missense probably damaging 0.98
R5093:Aftph UTSW 11 20709619 critical splice donor site probably null
R5160:Aftph UTSW 11 20712197 missense probably benign 0.03
R5288:Aftph UTSW 11 20726994 missense probably damaging 0.98
R5338:Aftph UTSW 11 20727203 missense probably benign 0.18
R5794:Aftph UTSW 11 20726955 unclassified probably null
R6747:Aftph UTSW 11 20726144 synonymous probably null
R7034:Aftph UTSW 11 20692498 missense probably damaging 1.00
R7284:Aftph UTSW 11 20726812 missense probably benign 0.00
R7371:Aftph UTSW 11 20726836 missense probably benign
X0028:Aftph UTSW 11 20726338 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTAGATAATCACAGCGTAAACAGG -3'
(R):5'- AGGCTAGTTCCTGGACTGTATC -3'

Sequencing Primer
(F):5'- TAATCACAGCGTAAACAGGAAAATAG -3'
(R):5'- GTGCTAGCTCTTGATTGC -3'
Posted On2018-10-18