Incidental Mutation 'R6876:Olfr1388'
ID536426
Institutional Source Beutler Lab
Gene Symbol Olfr1388
Ensembl Gene ENSMUSG00000047702
Gene Nameolfactory receptor 1388
SynonymsGA_x6K02T2QP88-5991012-5990077, MOR256-28
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R6876 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location49436624-49446103 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49444241 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 130 (L130P)
Ref Sequence ENSEMBL: ENSMUSP00000150160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055584] [ENSMUST00000215226]
Predicted Effect probably damaging
Transcript: ENSMUST00000055584
AA Change: L130P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053834
Gene: ENSMUSG00000047702
AA Change: L130P

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 3.7e-46 PFAM
Pfam:7TM_GPCR_Srsx 35 154 9.8e-7 PFAM
Pfam:7tm_1 41 289 7.6e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215226
AA Change: L130P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T C 13: 58,385,096 D20G probably damaging Het
Aasdh T C 5: 76,896,441 T201A probably damaging Het
Abca12 T A 1: 71,263,508 D2184V probably damaging Het
Abcf1 C T 17: 35,959,244 D641N probably benign Het
Adgrv1 C A 13: 81,155,154 probably null Het
Aftph T C 11: 20,709,744 E693G probably damaging Het
Ahnak A G 19: 9,014,120 D4256G probably damaging Het
Arv1 A G 8: 124,730,912 K185R probably damaging Het
Ces4a T A 8: 105,144,992 V258D possibly damaging Het
Col6a5 T C 9: 105,937,307 D502G unknown Het
Diaph1 A T 18: 37,896,373 H335Q unknown Het
Dtna G A 18: 23,611,110 V404I probably benign Het
Ephb1 T C 9: 101,984,120 D615G probably damaging Het
Gimap3 A T 6: 48,765,921 I25N probably damaging Het
Hao1 A G 2: 134,501,149 V274A probably benign Het
Hirip3 T C 7: 126,864,149 S426P probably damaging Het
Igkv4-69 T C 6: 69,283,834 D103G probably damaging Het
Kdm8 T C 7: 125,452,658 V141A probably benign Het
Mink1 G T 11: 70,607,435 A553S probably benign Het
Mpl T A 4: 118,457,120 Y60F probably damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo5a C A 9: 75,160,490 R609S probably benign Het
Myo5b A T 18: 74,707,955 H969L probably benign Het
Olfr354 T A 2: 36,907,822 I292N probably damaging Het
Olfr92 G C 17: 37,111,206 Q259E probably damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Prodh2 T A 7: 30,506,500 W207R probably damaging Het
Rfx6 A G 10: 51,719,991 K457E probably damaging Het
Sim1 A G 10: 50,983,695 E551G possibly damaging Het
Soat2 T C 15: 102,160,614 F358S probably damaging Het
Tes3-ps A G 13: 49,493,719 K24E probably benign Het
Txndc16 A G 14: 45,163,040 F335L possibly damaging Het
Unc45b T C 11: 82,922,912 Y382H probably benign Het
Vmn2r60 A G 7: 42,135,663 T100A probably null Het
Vmn2r93 T A 17: 18,305,188 H369Q probably benign Het
Yy1 A G 12: 108,806,592 I265V probably benign Het
Zfp54 A T 17: 21,433,977 K244N probably damaging Het
Other mutations in Olfr1388
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01015:Olfr1388 APN 11 49444374 missense probably damaging 1.00
IGL01346:Olfr1388 APN 11 49444768 missense probably benign 0.00
IGL01943:Olfr1388 APN 11 49444188 nonsense probably null
IGL03343:Olfr1388 APN 11 49444243 missense probably damaging 0.97
R1530:Olfr1388 UTSW 11 49443905 missense probably benign 0.27
R1699:Olfr1388 UTSW 11 49444289 missense possibly damaging 0.88
R2059:Olfr1388 UTSW 11 49444451 missense probably damaging 0.99
R2198:Olfr1388 UTSW 11 49443959 missense probably benign 0.01
R4782:Olfr1388 UTSW 11 49443869 missense probably benign 0.00
R4885:Olfr1388 UTSW 11 49444622 missense probably damaging 0.97
R4966:Olfr1388 UTSW 11 49444118 missense possibly damaging 0.94
R5165:Olfr1388 UTSW 11 49444376 missense probably damaging 1.00
R5173:Olfr1388 UTSW 11 49443886 missense probably benign 0.12
R5667:Olfr1388 UTSW 11 49444313 missense probably benign 0.00
R5671:Olfr1388 UTSW 11 49444313 missense probably benign 0.00
R5836:Olfr1388 UTSW 11 49444526 missense probably damaging 1.00
R6173:Olfr1388 UTSW 11 49444472 missense probably benign 0.01
R6801:Olfr1388 UTSW 11 49444342 missense probably benign 0.10
R6864:Olfr1388 UTSW 11 49443940 missense probably benign
R7386:Olfr1388 UTSW 11 49444400 missense possibly damaging 0.95
R8119:Olfr1388 UTSW 11 49444126 missense probably damaging 1.00
R8870:Olfr1388 UTSW 11 49444523 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGACCTTCGACTGCAAAC -3'
(R):5'- GGCCAACTTGAGGAATATGGGC -3'

Sequencing Primer
(F):5'- TGGACCTCTGCTACACCACG -3'
(R):5'- CCAACTTGAGGAATATGGGCATCTC -3'
Posted On2018-10-18