Incidental Mutation 'R6876:Mink1'
ID536427
Institutional Source Beutler Lab
Gene Symbol Mink1
Ensembl Gene ENSMUSG00000020827
Gene Namemisshapen-like kinase 1 (zebrafish)
SynonymsMap4k6, Ysk2, MINK, Misshapen/NIKs-related kinase
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6876 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location70562881-70614483 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 70607435 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 553 (A553S)
Ref Sequence ENSEMBL: ENSMUSP00000078234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072237] [ENSMUST00000072873] [ENSMUST00000079244] [ENSMUST00000102558] [ENSMUST00000102559]
Predicted Effect probably benign
Transcript: ENSMUST00000072237
AA Change: A556S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072091
Gene: ENSMUSG00000020827
AA Change: A556S

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
low complexity region 837 874 N/A INTRINSIC
CNH 1026 1324 1.58e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072873
AA Change: A556S

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000072649
Gene: ENSMUSG00000020827
AA Change: A556S

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
low complexity region 829 853 N/A INTRINSIC
CNH 1019 1317 1.58e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079244
AA Change: A553S

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000078234
Gene: ENSMUSG00000020827
AA Change: A553S

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 314 338 N/A INTRINSIC
coiled coil region 348 493 N/A INTRINSIC
low complexity region 554 566 N/A INTRINSIC
low complexity region 617 630 N/A INTRINSIC
low complexity region 643 656 N/A INTRINSIC
low complexity region 716 735 N/A INTRINSIC
low complexity region 826 850 N/A INTRINSIC
CNH 1016 1314 1.58e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102558
AA Change: A556S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000099618
Gene: ENSMUSG00000020827
AA Change: A556S

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 792 816 N/A INTRINSIC
CNH 982 1280 1.58e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102559
AA Change: A556S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000099619
Gene: ENSMUSG00000020827
AA Change: A556S

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 800 824 N/A INTRINSIC
CNH 990 1288 1.58e-113 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000117959
Gene: ENSMUSG00000020827
AA Change: A409S

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 140 2.3e-22 PFAM
Pfam:Pkinase 1 143 1.6e-30 PFAM
low complexity region 161 192 N/A INTRINSIC
coiled coil region 204 349 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 474 487 N/A INTRINSIC
low complexity region 500 513 N/A INTRINSIC
low complexity region 573 592 N/A INTRINSIC
low complexity region 691 728 N/A INTRINSIC
CNH 880 1178 1.58e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149845
Predicted Effect probably benign
Transcript: ENSMUST00000178764
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine kinase belonging to the germinal center kinase (GCK) family. The protein is structurally similar to the kinases that are related to NIK and may belong to a distinct subfamily of NIK-related kinases within the GCK family. Studies of the mouse homolog indicate an up-regulation of expression in the course of postnatal mouse cerebral development and activation of the cJun N-terminal kinase (JNK) and the p38 pathways. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T C 13: 58,385,096 D20G probably damaging Het
Aasdh T C 5: 76,896,441 T201A probably damaging Het
Abca12 T A 1: 71,263,508 D2184V probably damaging Het
Abcf1 C T 17: 35,959,244 D641N probably benign Het
Adgrv1 C A 13: 81,155,154 probably null Het
Aftph T C 11: 20,709,744 E693G probably damaging Het
Ahnak A G 19: 9,014,120 D4256G probably damaging Het
Arv1 A G 8: 124,730,912 K185R probably damaging Het
Ces4a T A 8: 105,144,992 V258D possibly damaging Het
Col6a5 T C 9: 105,937,307 D502G unknown Het
Diaph1 A T 18: 37,896,373 H335Q unknown Het
Dtna G A 18: 23,611,110 V404I probably benign Het
Ephb1 T C 9: 101,984,120 D615G probably damaging Het
Gimap3 A T 6: 48,765,921 I25N probably damaging Het
Hao1 A G 2: 134,501,149 V274A probably benign Het
Hirip3 T C 7: 126,864,149 S426P probably damaging Het
Igkv4-69 T C 6: 69,283,834 D103G probably damaging Het
Kdm8 T C 7: 125,452,658 V141A probably benign Het
Mpl T A 4: 118,457,120 Y60F probably damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo5a C A 9: 75,160,490 R609S probably benign Het
Myo5b A T 18: 74,707,955 H969L probably benign Het
Olfr1388 T C 11: 49,444,241 L130P probably damaging Het
Olfr354 T A 2: 36,907,822 I292N probably damaging Het
Olfr92 G C 17: 37,111,206 Q259E probably damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Prodh2 T A 7: 30,506,500 W207R probably damaging Het
Rfx6 A G 10: 51,719,991 K457E probably damaging Het
Sim1 A G 10: 50,983,695 E551G possibly damaging Het
Soat2 T C 15: 102,160,614 F358S probably damaging Het
Tes3-ps A G 13: 49,493,719 K24E probably benign Het
Txndc16 A G 14: 45,163,040 F335L possibly damaging Het
Unc45b T C 11: 82,922,912 Y382H probably benign Het
Vmn2r60 A G 7: 42,135,663 T100A probably null Het
Vmn2r93 T A 17: 18,305,188 H369Q probably benign Het
Yy1 A G 12: 108,806,592 I265V probably benign Het
Zfp54 A T 17: 21,433,977 K244N probably damaging Het
Other mutations in Mink1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Mink1 APN 11 70603812 missense probably damaging 0.99
IGL00709:Mink1 APN 11 70613019 missense probably damaging 0.99
IGL01064:Mink1 APN 11 70603481 missense probably benign 0.05
IGL02612:Mink1 APN 11 70597226 missense probably damaging 1.00
IGL02797:Mink1 APN 11 70610350 missense probably damaging 1.00
IGL03056:Mink1 APN 11 70612583 critical splice donor site probably null
IGL03066:Mink1 APN 11 70608889 missense probably benign 0.01
IGL03185:Mink1 APN 11 70603860 missense probably damaging 1.00
PIT4498001:Mink1 UTSW 11 70598888 missense probably benign 0.05
R0025:Mink1 UTSW 11 70613042 missense probably damaging 1.00
R0025:Mink1 UTSW 11 70613042 missense probably damaging 1.00
R0488:Mink1 UTSW 11 70597204 missense probably damaging 1.00
R0637:Mink1 UTSW 11 70601676 missense probably damaging 0.96
R0828:Mink1 UTSW 11 70610145 nonsense probably null
R1081:Mink1 UTSW 11 70607035 missense probably benign 0.07
R1175:Mink1 UTSW 11 70611340 missense probably benign 0.02
R1441:Mink1 UTSW 11 70607114 missense possibly damaging 0.72
R1532:Mink1 UTSW 11 70602007 missense probably null 1.00
R1545:Mink1 UTSW 11 70598891 missense possibly damaging 0.60
R1634:Mink1 UTSW 11 70608880 missense probably benign 0.00
R1932:Mink1 UTSW 11 70608428 critical splice donor site probably null
R2033:Mink1 UTSW 11 70612508 missense probably damaging 1.00
R2184:Mink1 UTSW 11 70603797 missense probably damaging 1.00
R2267:Mink1 UTSW 11 70601724 splice site probably null
R2268:Mink1 UTSW 11 70601724 splice site probably null
R2859:Mink1 UTSW 11 70612508 missense probably damaging 1.00
R3713:Mink1 UTSW 11 70608950 missense possibly damaging 0.93
R3714:Mink1 UTSW 11 70608950 missense possibly damaging 0.93
R3715:Mink1 UTSW 11 70608950 missense possibly damaging 0.93
R3716:Mink1 UTSW 11 70607761 missense probably damaging 0.98
R3717:Mink1 UTSW 11 70607761 missense probably damaging 0.98
R4607:Mink1 UTSW 11 70606067 missense possibly damaging 0.72
R4735:Mink1 UTSW 11 70609260 splice site probably null
R4790:Mink1 UTSW 11 70599041 missense probably damaging 0.99
R4847:Mink1 UTSW 11 70602028 missense probably damaging 1.00
R4860:Mink1 UTSW 11 70611592 missense probably damaging 0.98
R4860:Mink1 UTSW 11 70611592 missense probably damaging 0.98
R5081:Mink1 UTSW 11 70605144 missense probably damaging 0.98
R5310:Mink1 UTSW 11 70607343 missense probably benign 0.33
R5677:Mink1 UTSW 11 70605165 missense possibly damaging 0.66
R5767:Mink1 UTSW 11 70606075 missense possibly damaging 0.53
R5795:Mink1 UTSW 11 70607790 missense possibly damaging 0.86
R5888:Mink1 UTSW 11 70610059 unclassified probably benign
R5950:Mink1 UTSW 11 70609586 missense possibly damaging 0.81
R6024:Mink1 UTSW 11 70599089 missense possibly damaging 0.71
R6034:Mink1 UTSW 11 70607040 small deletion probably benign
R6034:Mink1 UTSW 11 70607040 small deletion probably benign
R6058:Mink1 UTSW 11 70611720 missense possibly damaging 0.96
R6144:Mink1 UTSW 11 70610652 missense possibly damaging 0.66
R6154:Mink1 UTSW 11 70610101 missense possibly damaging 0.46
R6218:Mink1 UTSW 11 70598894 missense possibly damaging 0.94
R6262:Mink1 UTSW 11 70603325 splice site probably null
R6269:Mink1 UTSW 11 70598987 missense probably damaging 1.00
R6273:Mink1 UTSW 11 70611435 nonsense probably null
R6301:Mink1 UTSW 11 70612294 missense possibly damaging 0.71
R6603:Mink1 UTSW 11 70609593 missense probably damaging 0.96
R7030:Mink1 UTSW 11 70607775 missense possibly damaging 0.46
R7050:Mink1 UTSW 11 70612332 missense possibly damaging 0.93
R7094:Mink1 UTSW 11 70610075 splice site probably null
R7135:Mink1 UTSW 11 70603503 missense probably damaging 1.00
R7238:Mink1 UTSW 11 70611479 critical splice donor site probably null
R7320:Mink1 UTSW 11 70599073 missense probably benign 0.23
R7396:Mink1 UTSW 11 70605168 missense possibly damaging 0.73
R7446:Mink1 UTSW 11 70609629 missense probably benign 0.18
R7723:Mink1 UTSW 11 70612910 missense probably benign 0.16
R7896:Mink1 UTSW 11 70612282 missense possibly damaging 0.71
R8058:Mink1 UTSW 11 70603768 nonsense probably null
R8082:Mink1 UTSW 11 70613277 missense possibly damaging 0.71
R8160:Mink1 UTSW 11 70606081 nonsense probably null
R8335:Mink1 UTSW 11 70609575 missense probably damaging 0.97
R8353:Mink1 UTSW 11 70610328 missense possibly damaging 0.70
R8453:Mink1 UTSW 11 70610328 missense possibly damaging 0.70
R8732:Mink1 UTSW 11 70610076 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCTGGGATGTTGTAACAAGC -3'
(R):5'- TAGTGCGCAGAAGACACCAG -3'

Sequencing Primer
(F):5'- CTGGGATGTTGTAACAAGCACTGAG -3'
(R):5'- CAGTGAGCACAAACATGTACTC -3'
Posted On2018-10-18