Incidental Mutation 'R6876:Yy1'
ID536429
Institutional Source Beutler Lab
Gene Symbol Yy1
Ensembl Gene ENSMUSG00000021264
Gene NameYY1 transcription factor
SynonymsNF-E1, UCRBP transcription factor, Yin Yang 1, delta transcription factor
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6876 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location108792973-108820148 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108806592 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 265 (I265V)
Ref Sequence ENSEMBL: ENSMUSP00000021692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021692]
Predicted Effect probably benign
Transcript: ENSMUST00000021692
AA Change: I265V

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000021692
Gene: ENSMUSG00000021264
AA Change: I265V

DomainStartEndE-ValueType
low complexity region 25 41 N/A INTRINSIC
low complexity region 42 82 N/A INTRINSIC
low complexity region 156 204 N/A INTRINSIC
PDB:4C5I|C 205 228 8e-9 PDB
low complexity region 257 273 N/A INTRINSIC
ZnF_C2H2 296 320 1.03e-2 SMART
ZnF_C2H2 325 347 2.2e-2 SMART
ZnF_C2H2 353 377 9.08e-4 SMART
ZnF_C2H2 383 407 9.88e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] YY1 is a ubiquitously distributed transcription factor belonging to the GLI-Kruppel class of zinc finger proteins. The protein is involved in repressing and activating a diverse number of promoters. YY1 may direct histone deacetylases and histone acetyltransferases to a promoter in order to activate or repress the promoter, thus implicating histone modification in the function of YY1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice die in utero shortly after implantation. Incomplete penetrance of embryonic growth retardation and exencephaly are observed in haploinsufficient mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T C 13: 58,385,096 D20G probably damaging Het
Aasdh T C 5: 76,896,441 T201A probably damaging Het
Abca12 T A 1: 71,263,508 D2184V probably damaging Het
Abcf1 C T 17: 35,959,244 D641N probably benign Het
Adgrv1 C A 13: 81,155,154 probably null Het
Aftph T C 11: 20,709,744 E693G probably damaging Het
Ahnak A G 19: 9,014,120 D4256G probably damaging Het
Arv1 A G 8: 124,730,912 K185R probably damaging Het
Ces4a T A 8: 105,144,992 V258D possibly damaging Het
Col6a5 T C 9: 105,937,307 D502G unknown Het
Diaph1 A T 18: 37,896,373 H335Q unknown Het
Dtna G A 18: 23,611,110 V404I probably benign Het
Ephb1 T C 9: 101,984,120 D615G probably damaging Het
Gimap3 A T 6: 48,765,921 I25N probably damaging Het
Hao1 A G 2: 134,501,149 V274A probably benign Het
Hirip3 T C 7: 126,864,149 S426P probably damaging Het
Igkv4-69 T C 6: 69,283,834 D103G probably damaging Het
Kdm8 T C 7: 125,452,658 V141A probably benign Het
Mink1 G T 11: 70,607,435 A553S probably benign Het
Mpl T A 4: 118,457,120 Y60F probably damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo5a C A 9: 75,160,490 R609S probably benign Het
Myo5b A T 18: 74,707,955 H969L probably benign Het
Olfr1388 T C 11: 49,444,241 L130P probably damaging Het
Olfr354 T A 2: 36,907,822 I292N probably damaging Het
Olfr92 G C 17: 37,111,206 Q259E probably damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Prodh2 T A 7: 30,506,500 W207R probably damaging Het
Rfx6 A G 10: 51,719,991 K457E probably damaging Het
Sim1 A G 10: 50,983,695 E551G possibly damaging Het
Soat2 T C 15: 102,160,614 F358S probably damaging Het
Tes3-ps A G 13: 49,493,719 K24E probably benign Het
Txndc16 A G 14: 45,163,040 F335L possibly damaging Het
Unc45b T C 11: 82,922,912 Y382H probably benign Het
Vmn2r60 A G 7: 42,135,663 T100A probably null Het
Vmn2r93 T A 17: 18,305,188 H369Q probably benign Het
Zfp54 A T 17: 21,433,977 K244N probably damaging Het
Other mutations in Yy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Yy1 APN 12 108815537 missense probably damaging 1.00
IGL02158:Yy1 APN 12 108814599 splice site probably benign
IGL02223:Yy1 APN 12 108793540 missense unknown
IGL02412:Yy1 APN 12 108794097 splice site probably benign
IGL02718:Yy1 APN 12 108815479 missense probably damaging 1.00
R1023:Yy1 UTSW 12 108793531 missense unknown
R1341:Yy1 UTSW 12 108793519 missense unknown
R1855:Yy1 UTSW 12 108793990 small insertion probably benign
R1989:Yy1 UTSW 12 108806608 missense probably damaging 1.00
R2022:Yy1 UTSW 12 108793990 small insertion probably benign
R4566:Yy1 UTSW 12 108812963 missense probably damaging 0.98
R4717:Yy1 UTSW 12 108794046 missense possibly damaging 0.50
R5041:Yy1 UTSW 12 108793631 small insertion probably benign
R5089:Yy1 UTSW 12 108793737 missense probably damaging 1.00
R5597:Yy1 UTSW 12 108815510 missense probably damaging 1.00
R5907:Yy1 UTSW 12 108806428 intron probably benign
R6878:Yy1 UTSW 12 108814756 missense probably damaging 1.00
R6923:Yy1 UTSW 12 108793668 missense probably benign 0.28
R8218:Yy1 UTSW 12 108793693 missense probably benign 0.00
R8378:Yy1 UTSW 12 108793636 missense unknown
R8808:Yy1 UTSW 12 108793580 small deletion probably benign
R8809:Yy1 UTSW 12 108793580 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TTCCAAAGGATTGAGGACACAC -3'
(R):5'- TCACCAAAACCGTTTGCTTTTG -3'

Sequencing Primer
(F):5'- CTTATGAGGATTCCACTGAAAAGC -3'
(R):5'- GTTTTCAGAGTTGTCCCTAGAGAAAG -3'
Posted On2018-10-18