Incidental Mutation 'R6876:2210016F16Rik'
ID536431
Institutional Source Beutler Lab
Gene Symbol 2210016F16Rik
Ensembl Gene ENSMUSG00000021550
Gene NameRIKEN cDNA 2210016F16 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R6876 (G1)
Quality Score152.008
Status Not validated
Chromosome13
Chromosomal Location58379817-58385225 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58385096 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 20 (D20G)
Ref Sequence ENSEMBL: ENSMUSP00000022032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022032]
Predicted Effect probably damaging
Transcript: ENSMUST00000022032
AA Change: D20G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022032
Gene: ENSMUSG00000021550
AA Change: D20G

DomainStartEndE-ValueType
low complexity region 31 41 N/A INTRINSIC
Pfam:Q_salvage 53 338 9.7e-122 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh T C 5: 76,896,441 T201A probably damaging Het
Abca12 T A 1: 71,263,508 D2184V probably damaging Het
Abcf1 C T 17: 35,959,244 D641N probably benign Het
Adgrv1 C A 13: 81,155,154 probably null Het
Aftph T C 11: 20,709,744 E693G probably damaging Het
Ahnak A G 19: 9,014,120 D4256G probably damaging Het
Arv1 A G 8: 124,730,912 K185R probably damaging Het
Ces4a T A 8: 105,144,992 V258D possibly damaging Het
Col6a5 T C 9: 105,937,307 D502G unknown Het
Diaph1 A T 18: 37,896,373 H335Q unknown Het
Dtna G A 18: 23,611,110 V404I probably benign Het
Ephb1 T C 9: 101,984,120 D615G probably damaging Het
Gimap3 A T 6: 48,765,921 I25N probably damaging Het
Hao1 A G 2: 134,501,149 V274A probably benign Het
Hirip3 T C 7: 126,864,149 S426P probably damaging Het
Igkv4-69 T C 6: 69,283,834 D103G probably damaging Het
Kdm8 T C 7: 125,452,658 V141A probably benign Het
Mink1 G T 11: 70,607,435 A553S probably benign Het
Mpl T A 4: 118,457,120 Y60F probably damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo5a C A 9: 75,160,490 R609S probably benign Het
Myo5b A T 18: 74,707,955 H969L probably benign Het
Olfr1388 T C 11: 49,444,241 L130P probably damaging Het
Olfr354 T A 2: 36,907,822 I292N probably damaging Het
Olfr92 G C 17: 37,111,206 Q259E probably damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Prodh2 T A 7: 30,506,500 W207R probably damaging Het
Rfx6 A G 10: 51,719,991 K457E probably damaging Het
Sim1 A G 10: 50,983,695 E551G possibly damaging Het
Soat2 T C 15: 102,160,614 F358S probably damaging Het
Tes3-ps A G 13: 49,493,719 K24E probably benign Het
Txndc16 A G 14: 45,163,040 F335L possibly damaging Het
Unc45b T C 11: 82,922,912 Y382H probably benign Het
Vmn2r60 A G 7: 42,135,663 T100A probably null Het
Vmn2r93 T A 17: 18,305,188 H369Q probably benign Het
Yy1 A G 12: 108,806,592 I265V probably benign Het
Zfp54 A T 17: 21,433,977 K244N probably damaging Het
Other mutations in 2210016F16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:2210016F16Rik APN 13 58381976 missense probably damaging 1.00
IGL02302:2210016F16Rik APN 13 58381935 missense probably damaging 1.00
PIT1430001:2210016F16Rik UTSW 13 58385013 nonsense probably null
R0055:2210016F16Rik UTSW 13 58384166 missense probably damaging 1.00
R0055:2210016F16Rik UTSW 13 58384166 missense probably damaging 1.00
R2874:2210016F16Rik UTSW 13 58382570 missense probably damaging 1.00
R3954:2210016F16Rik UTSW 13 58384389 missense probably damaging 0.97
R3956:2210016F16Rik UTSW 13 58384389 missense probably damaging 0.97
R4012:2210016F16Rik UTSW 13 58381986 nonsense probably null
R4212:2210016F16Rik UTSW 13 58381991 missense probably damaging 1.00
R4469:2210016F16Rik UTSW 13 58382425 missense probably damaging 1.00
R4712:2210016F16Rik UTSW 13 58381803 missense probably benign 0.06
R5401:2210016F16Rik UTSW 13 58382591 missense probably benign
R6957:2210016F16Rik UTSW 13 58381961 missense probably damaging 1.00
R7285:2210016F16Rik UTSW 13 58384385 missense probably damaging 1.00
R7599:2210016F16Rik UTSW 13 58381835 missense probably damaging 0.99
R8553:2210016F16Rik UTSW 13 58384880 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGCACCCACCCAGGTTTAAG -3'
(R):5'- AAGCCTTCCTCAAAGACGG -3'

Sequencing Primer
(F):5'- TTTAAGGCTGGCACCCAC -3'
(R):5'- GGCCGAACACAAGGAGTCC -3'
Posted On2018-10-18