Incidental Mutation 'R6876:Txndc16'
ID536433
Institutional Source Beutler Lab
Gene Symbol Txndc16
Ensembl Gene ENSMUSG00000021830
Gene Namethioredoxin domain containing 16
Synonyms5730420B22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R6876 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location45133465-45220328 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45163040 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 335 (F335L)
Ref Sequence ENSEMBL: ENSMUSP00000123023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022377] [ENSMUST00000123879] [ENSMUST00000139526] [ENSMUST00000147853]
Predicted Effect probably benign
Transcript: ENSMUST00000022377
AA Change: F335L

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000022377
Gene: ENSMUSG00000021830
AA Change: F335L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 354 367 N/A INTRINSIC
Pfam:Thioredoxin 394 496 1.9e-12 PFAM
Pfam:Thioredoxin_6 534 723 2.3e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000123879
AA Change: F335L

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000123023
Gene: ENSMUSG00000021830
AA Change: F335L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 354 367 N/A INTRINSIC
Pfam:Thioredoxin 394 496 1.9e-12 PFAM
Pfam:Thioredoxin_6 534 723 2.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139526
AA Change: F335L

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000120287
Gene: ENSMUSG00000021830
AA Change: F335L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 354 367 N/A INTRINSIC
Pfam:Thioredoxin 394 496 1e-12 PFAM
Pfam:Thioredoxin_6 534 723 7.3e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147853
Predicted Effect probably benign
Transcript: ENSMUST00000156600
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T C 13: 58,385,096 D20G probably damaging Het
Aasdh T C 5: 76,896,441 T201A probably damaging Het
Abca12 T A 1: 71,263,508 D2184V probably damaging Het
Abcf1 C T 17: 35,959,244 D641N probably benign Het
Adgrv1 C A 13: 81,155,154 probably null Het
Aftph T C 11: 20,709,744 E693G probably damaging Het
Ahnak A G 19: 9,014,120 D4256G probably damaging Het
Arv1 A G 8: 124,730,912 K185R probably damaging Het
Ces4a T A 8: 105,144,992 V258D possibly damaging Het
Col6a5 T C 9: 105,937,307 D502G unknown Het
Diaph1 A T 18: 37,896,373 H335Q unknown Het
Dtna G A 18: 23,611,110 V404I probably benign Het
Ephb1 T C 9: 101,984,120 D615G probably damaging Het
Gimap3 A T 6: 48,765,921 I25N probably damaging Het
Hao1 A G 2: 134,501,149 V274A probably benign Het
Hirip3 T C 7: 126,864,149 S426P probably damaging Het
Igkv4-69 T C 6: 69,283,834 D103G probably damaging Het
Kdm8 T C 7: 125,452,658 V141A probably benign Het
Mink1 G T 11: 70,607,435 A553S probably benign Het
Mpl T A 4: 118,457,120 Y60F probably damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo5a C A 9: 75,160,490 R609S probably benign Het
Myo5b A T 18: 74,707,955 H969L probably benign Het
Olfr1388 T C 11: 49,444,241 L130P probably damaging Het
Olfr354 T A 2: 36,907,822 I292N probably damaging Het
Olfr92 G C 17: 37,111,206 Q259E probably damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Prodh2 T A 7: 30,506,500 W207R probably damaging Het
Rfx6 A G 10: 51,719,991 K457E probably damaging Het
Sim1 A G 10: 50,983,695 E551G possibly damaging Het
Soat2 T C 15: 102,160,614 F358S probably damaging Het
Tes3-ps A G 13: 49,493,719 K24E probably benign Het
Unc45b T C 11: 82,922,912 Y382H probably benign Het
Vmn2r60 A G 7: 42,135,663 T100A probably null Het
Vmn2r93 T A 17: 18,305,188 H369Q probably benign Het
Yy1 A G 12: 108,806,592 I265V probably benign Het
Zfp54 A T 17: 21,433,977 K244N probably damaging Het
Other mutations in Txndc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Txndc16 APN 14 45162350 missense probably damaging 0.99
IGL00427:Txndc16 APN 14 45145090 splice site probably benign
IGL02554:Txndc16 APN 14 45172538 missense probably damaging 1.00
IGL02666:Txndc16 APN 14 45211150 splice site probably benign
IGL02707:Txndc16 APN 14 45162273 missense probably benign
IGL03198:Txndc16 APN 14 45151484 splice site probably benign
IGL03256:Txndc16 APN 14 45151896 missense probably damaging 1.00
R0647:Txndc16 UTSW 14 45169275 missense probably damaging 1.00
R0647:Txndc16 UTSW 14 45165361 nonsense probably null
R0838:Txndc16 UTSW 14 45165419 splice site probably benign
R1035:Txndc16 UTSW 14 45172563 missense possibly damaging 0.92
R1116:Txndc16 UTSW 14 45162985 missense probably benign 0.06
R1511:Txndc16 UTSW 14 45151887 missense probably damaging 0.97
R2114:Txndc16 UTSW 14 45145027 missense probably benign 0.00
R2139:Txndc16 UTSW 14 45172589 missense probably damaging 1.00
R3784:Txndc16 UTSW 14 45165886 missense probably damaging 1.00
R3801:Txndc16 UTSW 14 45151352 missense possibly damaging 0.85
R5215:Txndc16 UTSW 14 45211140 intron probably benign
R5620:Txndc16 UTSW 14 45135878 missense possibly damaging 0.86
R5726:Txndc16 UTSW 14 45165764 missense probably benign 0.38
R6297:Txndc16 UTSW 14 45151786 missense probably benign 0.10
R6603:Txndc16 UTSW 14 45151767 missense probably damaging 0.99
R6626:Txndc16 UTSW 14 45161335 splice site probably null
R7102:Txndc16 UTSW 14 45205382 missense probably benign 0.00
R7166:Txndc16 UTSW 14 45183154 missense probably benign 0.22
R7465:Txndc16 UTSW 14 45165388 missense probably damaging 0.97
R7670:Txndc16 UTSW 14 45135867 nonsense probably null
R7684:Txndc16 UTSW 14 45147868 missense possibly damaging 0.83
R7783:Txndc16 UTSW 14 45144960 missense probably benign 0.02
R8316:Txndc16 UTSW 14 45211184 missense probably damaging 1.00
R8838:Txndc16 UTSW 14 45140571 missense probably damaging 1.00
R8926:Txndc16 UTSW 14 45169314 missense possibly damaging 0.93
RF013:Txndc16 UTSW 14 45169338 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GAGAAAGCAGCCTGACATCTG -3'
(R):5'- GGCTACTTGTAAGTAAATACGGGG -3'

Sequencing Primer
(F):5'- AGCCTGACATCTGCTCACC -3'
(R):5'- TAAATACGGGGTACTGCTTAGC -3'
Posted On2018-10-18