Incidental Mutation 'R6876:Txndc16'
ID 536433
Institutional Source Beutler Lab
Gene Symbol Txndc16
Ensembl Gene ENSMUSG00000021830
Gene Name thioredoxin domain containing 16
Synonyms 5730420B22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock # R6876 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 45133465-45220328 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 45163040 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 335 (F335L)
Ref Sequence ENSEMBL: ENSMUSP00000123023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022377] [ENSMUST00000123879] [ENSMUST00000139526] [ENSMUST00000147853]
AlphaFold Q7TN22
Predicted Effect probably benign
Transcript: ENSMUST00000022377
AA Change: F335L

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000022377
Gene: ENSMUSG00000021830
AA Change: F335L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 354 367 N/A INTRINSIC
Pfam:Thioredoxin 394 496 1.9e-12 PFAM
Pfam:Thioredoxin_6 534 723 2.3e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000123879
AA Change: F335L

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000123023
Gene: ENSMUSG00000021830
AA Change: F335L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 354 367 N/A INTRINSIC
Pfam:Thioredoxin 394 496 1.9e-12 PFAM
Pfam:Thioredoxin_6 534 723 2.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139526
AA Change: F335L

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000120287
Gene: ENSMUSG00000021830
AA Change: F335L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 354 367 N/A INTRINSIC
Pfam:Thioredoxin 394 496 1e-12 PFAM
Pfam:Thioredoxin_6 534 723 7.3e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147853
Predicted Effect probably benign
Transcript: ENSMUST00000156600
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T C 13: 58,385,096 D20G probably damaging Het
Aasdh T C 5: 76,896,441 T201A probably damaging Het
Abca12 T A 1: 71,263,508 D2184V probably damaging Het
Abcf1 C T 17: 35,959,244 D641N probably benign Het
Adgrv1 C A 13: 81,155,154 probably null Het
Aftph T C 11: 20,709,744 E693G probably damaging Het
Ahnak A G 19: 9,014,120 D4256G probably damaging Het
Arv1 A G 8: 124,730,912 K185R probably damaging Het
Ces4a T A 8: 105,144,992 V258D possibly damaging Het
Col6a5 T C 9: 105,937,307 D502G unknown Het
Diaph1 A T 18: 37,896,373 H335Q unknown Het
Dtna G A 18: 23,611,110 V404I probably benign Het
Ephb1 T C 9: 101,984,120 D615G probably damaging Het
Gimap3 A T 6: 48,765,921 I25N probably damaging Het
Hao1 A G 2: 134,501,149 V274A probably benign Het
Hirip3 T C 7: 126,864,149 S426P probably damaging Het
Igkv4-69 T C 6: 69,283,834 D103G probably damaging Het
Kdm8 T C 7: 125,452,658 V141A probably benign Het
Mink1 G T 11: 70,607,435 A553S probably benign Het
Mpl T A 4: 118,457,120 Y60F probably damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo5a C A 9: 75,160,490 R609S probably benign Het
Myo5b A T 18: 74,707,955 H969L probably benign Het
Olfr1388 T C 11: 49,444,241 L130P probably damaging Het
Olfr354 T A 2: 36,907,822 I292N probably damaging Het
Olfr92 G C 17: 37,111,206 Q259E probably damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Prodh2 T A 7: 30,506,500 W207R probably damaging Het
Rfx6 A G 10: 51,719,991 K457E probably damaging Het
Sim1 A G 10: 50,983,695 E551G possibly damaging Het
Soat2 T C 15: 102,160,614 F358S probably damaging Het
Tes3-ps A G 13: 49,493,719 K24E probably benign Het
Unc45b T C 11: 82,922,912 Y382H probably benign Het
Vmn2r60 A G 7: 42,135,663 T100A probably null Het
Vmn2r93 T A 17: 18,305,188 H369Q probably benign Het
Yy1 A G 12: 108,806,592 I265V probably benign Het
Zfp54 A T 17: 21,433,977 K244N probably damaging Het
Other mutations in Txndc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Txndc16 APN 14 45162350 missense probably damaging 0.99
IGL00427:Txndc16 APN 14 45145090 splice site probably benign
IGL02554:Txndc16 APN 14 45172538 missense probably damaging 1.00
IGL02666:Txndc16 APN 14 45211150 splice site probably benign
IGL02707:Txndc16 APN 14 45162273 missense probably benign
IGL03198:Txndc16 APN 14 45151484 splice site probably benign
IGL03256:Txndc16 APN 14 45151896 missense probably damaging 1.00
R0647:Txndc16 UTSW 14 45169275 missense probably damaging 1.00
R0647:Txndc16 UTSW 14 45165361 nonsense probably null
R0838:Txndc16 UTSW 14 45165419 splice site probably benign
R1035:Txndc16 UTSW 14 45172563 missense possibly damaging 0.92
R1116:Txndc16 UTSW 14 45162985 missense probably benign 0.06
R1511:Txndc16 UTSW 14 45151887 missense probably damaging 0.97
R2114:Txndc16 UTSW 14 45145027 missense probably benign 0.00
R2139:Txndc16 UTSW 14 45172589 missense probably damaging 1.00
R3784:Txndc16 UTSW 14 45165886 missense probably damaging 1.00
R3801:Txndc16 UTSW 14 45151352 missense possibly damaging 0.85
R5215:Txndc16 UTSW 14 45211140 intron probably benign
R5620:Txndc16 UTSW 14 45135878 missense possibly damaging 0.86
R5726:Txndc16 UTSW 14 45165764 missense probably benign 0.38
R6297:Txndc16 UTSW 14 45151786 missense probably benign 0.10
R6603:Txndc16 UTSW 14 45151767 missense probably damaging 0.99
R6626:Txndc16 UTSW 14 45161335 splice site probably null
R7102:Txndc16 UTSW 14 45205382 missense probably benign 0.00
R7166:Txndc16 UTSW 14 45183154 missense probably benign 0.22
R7465:Txndc16 UTSW 14 45165388 missense probably damaging 0.97
R7670:Txndc16 UTSW 14 45135867 nonsense probably null
R7684:Txndc16 UTSW 14 45147868 missense possibly damaging 0.83
R7783:Txndc16 UTSW 14 45144960 missense probably benign 0.02
R8316:Txndc16 UTSW 14 45211184 missense probably damaging 1.00
R8838:Txndc16 UTSW 14 45140571 missense probably damaging 1.00
R8926:Txndc16 UTSW 14 45169314 missense possibly damaging 0.93
R9169:Txndc16 UTSW 14 45135928 missense probably damaging 1.00
R9327:Txndc16 UTSW 14 45141991 missense probably benign 0.00
R9489:Txndc16 UTSW 14 45205342 missense probably damaging 1.00
R9500:Txndc16 UTSW 14 45169341 missense probably null 0.00
R9605:Txndc16 UTSW 14 45205342 missense probably damaging 1.00
R9632:Txndc16 UTSW 14 45163010 missense probably benign 0.00
R9710:Txndc16 UTSW 14 45163010 missense probably benign 0.00
RF013:Txndc16 UTSW 14 45169338 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GAGAAAGCAGCCTGACATCTG -3'
(R):5'- GGCTACTTGTAAGTAAATACGGGG -3'

Sequencing Primer
(F):5'- AGCCTGACATCTGCTCACC -3'
(R):5'- TAAATACGGGGTACTGCTTAGC -3'
Posted On 2018-10-18