Incidental Mutation 'R6876:Soat2'
ID536434
Institutional Source Beutler Lab
Gene Symbol Soat2
Ensembl Gene ENSMUSG00000023045
Gene Namesterol O-acyltransferase 2
SynonymsACAT2, D15Wsu97e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R6876 (G1)
Quality Score200.009
Status Not validated
Chromosome15
Chromosomal Location102150526-102163469 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102160614 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 358 (F358S)
Ref Sequence ENSEMBL: ENSMUSP00000023806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023806]
Predicted Effect probably damaging
Transcript: ENSMUST00000023806
AA Change: F358S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023806
Gene: ENSMUSG00000023045
AA Change: F358S

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
transmembrane domain 121 143 N/A INTRINSIC
Pfam:MBOAT 147 497 3.3e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160465
SMART Domains Protein: ENSMUSP00000124628
Gene: ENSMUSG00000023045

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
transmembrane domain 92 114 N/A INTRINSIC
transmembrane domain 134 156 N/A INTRINSIC
transmembrane domain 163 185 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Summary:This gene is a member of a small family of acyl coenzyme A:cholesterol acyltransferases. The gene encodes a membrane-bound enzyme localized in the endoplasmic reticulum that produces intracellular cholesterol esters from long-chain fatty acyl CoA and cholesterol. The cholesterol esters are then stored as cytoplasmic lipid droplets inside the cell. The enzyme is implicated in cholesterol absorption in the intestine and in the assembly and secretion of apolipoprotein B-containing lipoproteins such as very low density lipoprotein (VLDL). Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant animals exhibit elevated serum triglyceride levels and are resistant to fatty liver, hyperlipidemia, and gallstone development when fed a high fat, high cholesterol diet. When fed a Western diet homozygous mutant animals exhibit elevated HDL levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T C 13: 58,385,096 D20G probably damaging Het
Aasdh T C 5: 76,896,441 T201A probably damaging Het
Abca12 T A 1: 71,263,508 D2184V probably damaging Het
Abcf1 C T 17: 35,959,244 D641N probably benign Het
Adgrv1 C A 13: 81,155,154 probably null Het
Aftph T C 11: 20,709,744 E693G probably damaging Het
Ahnak A G 19: 9,014,120 D4256G probably damaging Het
Arv1 A G 8: 124,730,912 K185R probably damaging Het
Ces4a T A 8: 105,144,992 V258D possibly damaging Het
Col6a5 T C 9: 105,937,307 D502G unknown Het
Diaph1 A T 18: 37,896,373 H335Q unknown Het
Dtna G A 18: 23,611,110 V404I probably benign Het
Ephb1 T C 9: 101,984,120 D615G probably damaging Het
Gimap3 A T 6: 48,765,921 I25N probably damaging Het
Hao1 A G 2: 134,501,149 V274A probably benign Het
Hirip3 T C 7: 126,864,149 S426P probably damaging Het
Igkv4-69 T C 6: 69,283,834 D103G probably damaging Het
Kdm8 T C 7: 125,452,658 V141A probably benign Het
Mink1 G T 11: 70,607,435 A553S probably benign Het
Mpl T A 4: 118,457,120 Y60F probably damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo5a C A 9: 75,160,490 R609S probably benign Het
Myo5b A T 18: 74,707,955 H969L probably benign Het
Olfr1388 T C 11: 49,444,241 L130P probably damaging Het
Olfr354 T A 2: 36,907,822 I292N probably damaging Het
Olfr92 G C 17: 37,111,206 Q259E probably damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Prodh2 T A 7: 30,506,500 W207R probably damaging Het
Rfx6 A G 10: 51,719,991 K457E probably damaging Het
Sim1 A G 10: 50,983,695 E551G possibly damaging Het
Tes3-ps A G 13: 49,493,719 K24E probably benign Het
Txndc16 A G 14: 45,163,040 F335L possibly damaging Het
Unc45b T C 11: 82,922,912 Y382H probably benign Het
Vmn2r60 A G 7: 42,135,663 T100A probably null Het
Vmn2r93 T A 17: 18,305,188 H369Q probably benign Het
Yy1 A G 12: 108,806,592 I265V probably benign Het
Zfp54 A T 17: 21,433,977 K244N probably damaging Het
Other mutations in Soat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02458:Soat2 APN 15 102162115 missense probably damaging 0.96
IGL03093:Soat2 APN 15 102157643 missense probably damaging 1.00
R0091:Soat2 UTSW 15 102158139 missense probably damaging 1.00
R0391:Soat2 UTSW 15 102158753 missense possibly damaging 0.92
R0396:Soat2 UTSW 15 102150707 unclassified probably benign
R1078:Soat2 UTSW 15 102153138 splice site probably null
R3421:Soat2 UTSW 15 102156809 splice site probably benign
R3422:Soat2 UTSW 15 102156809 splice site probably benign
R3754:Soat2 UTSW 15 102157078 missense probably damaging 1.00
R4062:Soat2 UTSW 15 102161091 missense possibly damaging 0.85
R4623:Soat2 UTSW 15 102157709 intron probably benign
R5004:Soat2 UTSW 15 102161111 missense probably damaging 1.00
R5808:Soat2 UTSW 15 102154025 splice site probably null
R6481:Soat2 UTSW 15 102162055 missense probably damaging 1.00
R6595:Soat2 UTSW 15 102160593 missense probably damaging 0.98
R7345:Soat2 UTSW 15 102162578 missense probably benign 0.13
R7429:Soat2 UTSW 15 102154300 missense probably damaging 1.00
R7572:Soat2 UTSW 15 102154021 critical splice donor site probably null
R7653:Soat2 UTSW 15 102162578 missense probably damaging 1.00
R7867:Soat2 UTSW 15 102151163 critical splice donor site probably null
R7910:Soat2 UTSW 15 102160671 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAATTTCCAAGGGTCAGGGG -3'
(R):5'- CTTGCTGCATCATCCACACAG -3'

Sequencing Primer
(F):5'- CTAGGGCAGGGTCAAGCACAC -3'
(R):5'- ACATTGCTCACGGCTGGAGAC -3'
Posted On2018-10-18