Incidental Mutation 'R6876:Zfp54'
ID536436
Institutional Source Beutler Lab
Gene Symbol Zfp54
Ensembl Gene ENSMUSG00000023882
Gene Namezinc finger protein 54
SynonymsKRAB10, Zfp-54, Zfp76, clone 18
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6876 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location21423227-21435640 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21433977 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 244 (K244N)
Ref Sequence ENSEMBL: ENSMUSP00000132983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007884] [ENSMUST00000165230] [ENSMUST00000167749]
Predicted Effect probably damaging
Transcript: ENSMUST00000007884
AA Change: K244N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000007884
Gene: ENSMUSG00000023882
AA Change: K244N

DomainStartEndE-ValueType
KRAB 13 73 8.44e-22 SMART
ZnF_C2H2 211 233 1.69e-3 SMART
ZnF_C2H2 243 265 6.88e-4 SMART
ZnF_C2H2 271 293 2.12e-4 SMART
ZnF_C2H2 299 321 6.67e-2 SMART
ZnF_C2H2 327 349 7.67e-2 SMART
ZnF_C2H2 355 377 2.71e-2 SMART
ZnF_C2H2 383 403 6.24e0 SMART
ZnF_C2H2 411 433 5.99e-4 SMART
ZnF_C2H2 439 461 1.69e-3 SMART
ZnF_C2H2 467 489 2.43e-4 SMART
ZnF_C2H2 495 517 2.3e-5 SMART
ZnF_C2H2 523 545 8.22e-2 SMART
ZnF_C2H2 551 573 4.17e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165230
AA Change: K244N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132983
Gene: ENSMUSG00000023882
AA Change: K244N

DomainStartEndE-ValueType
KRAB 13 73 8.44e-22 SMART
ZnF_C2H2 211 233 1.69e-3 SMART
ZnF_C2H2 243 265 6.88e-4 SMART
ZnF_C2H2 271 293 2.12e-4 SMART
ZnF_C2H2 299 321 6.67e-2 SMART
ZnF_C2H2 327 349 7.67e-2 SMART
ZnF_C2H2 355 377 2.71e-2 SMART
ZnF_C2H2 383 403 6.24e0 SMART
ZnF_C2H2 411 433 5.99e-4 SMART
ZnF_C2H2 439 461 1.69e-3 SMART
ZnF_C2H2 467 489 2.43e-4 SMART
ZnF_C2H2 495 517 2.3e-5 SMART
ZnF_C2H2 523 545 8.22e-2 SMART
ZnF_C2H2 551 573 4.17e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167749
SMART Domains Protein: ENSMUSP00000127089
Gene: ENSMUSG00000023882

DomainStartEndE-ValueType
KRAB 13 73 8.44e-22 SMART
ZnF_C2H2 211 233 1.69e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T C 13: 58,385,096 D20G probably damaging Het
Aasdh T C 5: 76,896,441 T201A probably damaging Het
Abca12 T A 1: 71,263,508 D2184V probably damaging Het
Abcf1 C T 17: 35,959,244 D641N probably benign Het
Adgrv1 C A 13: 81,155,154 probably null Het
Aftph T C 11: 20,709,744 E693G probably damaging Het
Ahnak A G 19: 9,014,120 D4256G probably damaging Het
Arv1 A G 8: 124,730,912 K185R probably damaging Het
Ces4a T A 8: 105,144,992 V258D possibly damaging Het
Col6a5 T C 9: 105,937,307 D502G unknown Het
Diaph1 A T 18: 37,896,373 H335Q unknown Het
Dtna G A 18: 23,611,110 V404I probably benign Het
Ephb1 T C 9: 101,984,120 D615G probably damaging Het
Gimap3 A T 6: 48,765,921 I25N probably damaging Het
Hao1 A G 2: 134,501,149 V274A probably benign Het
Hirip3 T C 7: 126,864,149 S426P probably damaging Het
Igkv4-69 T C 6: 69,283,834 D103G probably damaging Het
Kdm8 T C 7: 125,452,658 V141A probably benign Het
Mink1 G T 11: 70,607,435 A553S probably benign Het
Mpl T A 4: 118,457,120 Y60F probably damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo5a C A 9: 75,160,490 R609S probably benign Het
Myo5b A T 18: 74,707,955 H969L probably benign Het
Olfr1388 T C 11: 49,444,241 L130P probably damaging Het
Olfr354 T A 2: 36,907,822 I292N probably damaging Het
Olfr92 G C 17: 37,111,206 Q259E probably damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Prodh2 T A 7: 30,506,500 W207R probably damaging Het
Rfx6 A G 10: 51,719,991 K457E probably damaging Het
Sim1 A G 10: 50,983,695 E551G possibly damaging Het
Soat2 T C 15: 102,160,614 F358S probably damaging Het
Tes3-ps A G 13: 49,493,719 K24E probably benign Het
Txndc16 A G 14: 45,163,040 F335L possibly damaging Het
Unc45b T C 11: 82,922,912 Y382H probably benign Het
Vmn2r60 A G 7: 42,135,663 T100A probably null Het
Vmn2r93 T A 17: 18,305,188 H369Q probably benign Het
Yy1 A G 12: 108,806,592 I265V probably benign Het
Other mutations in Zfp54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Zfp54 APN 17 21433559 missense possibly damaging 0.62
IGL00425:Zfp54 APN 17 21430297 missense probably damaging 1.00
IGL02830:Zfp54 APN 17 21433456 missense probably damaging 1.00
IGL03037:Zfp54 APN 17 21430215 missense probably damaging 0.99
R1853:Zfp54 UTSW 17 21434142 nonsense probably null
R1855:Zfp54 UTSW 17 21434142 nonsense probably null
R1915:Zfp54 UTSW 17 21434152 missense probably benign
R3803:Zfp54 UTSW 17 21433552 missense possibly damaging 0.58
R4430:Zfp54 UTSW 17 21434960 missense probably damaging 0.98
R4724:Zfp54 UTSW 17 21433403 missense probably damaging 0.96
R4799:Zfp54 UTSW 17 21434140 missense probably damaging 1.00
R5197:Zfp54 UTSW 17 21434180 missense probably benign 0.12
R5400:Zfp54 UTSW 17 21433700 missense probably benign 0.05
R5422:Zfp54 UTSW 17 21434526 missense probably benign 0.00
R5566:Zfp54 UTSW 17 21433444 missense probably damaging 0.99
R6460:Zfp54 UTSW 17 21433742 missense probably benign
R6528:Zfp54 UTSW 17 21433474 nonsense probably null
R7296:Zfp54 UTSW 17 21433582 missense probably benign 0.11
R7342:Zfp54 UTSW 17 21427752 start gained probably benign
R7660:Zfp54 UTSW 17 21434239 missense probably damaging 1.00
R7701:Zfp54 UTSW 17 21434095 missense probably benign 0.02
R7796:Zfp54 UTSW 17 21434720 missense probably damaging 1.00
R8087:Zfp54 UTSW 17 21434998 missense probably damaging 0.99
R8412:Zfp54 UTSW 17 21434648 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATCTCTACACACAGTCTCATGC -3'
(R):5'- ATGAAAGACCTTGCCACAGTATTGAC -3'

Sequencing Primer
(F):5'- TCCACACCAGTGTATGAAATATGGG -3'
(R):5'- TGACAACTATAACATTCCTCTGCAG -3'
Posted On2018-10-18