Incidental Mutation 'R6876:Diaph1'
ID536440
Institutional Source Beutler Lab
Gene Symbol Diaph1
Ensembl Gene ENSMUSG00000024456
Gene Namediaphanous related formin 1
SynonymsDrf1, Dia1, D18Wsu154e, mDia1, Diap1, p140mDia
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6876 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location37843601-37935476 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37896373 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 335 (H335Q)
Ref Sequence ENSEMBL: ENSMUSP00000111297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025337] [ENSMUST00000080033] [ENSMUST00000115629] [ENSMUST00000115631] [ENSMUST00000115634]
PDB Structure
Crystal structure of the core FH2 domain of mouse mDia1 [X-RAY DIFFRACTION]
Crystal structure of mDIA1 GBD-FH3 in complex with RhoC-GMPPNP [X-RAY DIFFRACTION]
Crystal structure of the N-terminal mDia1 Armadillo Repeat Region and Dimerisation Domain in complex with the mDia1 autoregulatory domain (DAD) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE DIMERIC REGULATORY DOMAIN OF MOUSE DIAPHANEOUS-RELATED FORMIN (DRF), MDIA1 [X-RAY DIFFRACTION]
Crystal structure of the autoinhibitory switch in Formin mDia1; the DID/DAD complex [X-RAY DIFFRACTION]
Mouse Profilin IIa in complex with a double repeat from the FH1 domain of mDia1 [X-RAY DIFFRACTION]
Crystal structure of MDIA1-TSH GBD-FH3 in complex with CDC42-GMPPNP [X-RAY DIFFRACTION]
Crystal structure of complex between amino and carboxy terminal fragments of mDia1 [X-RAY DIFFRACTION]
Autoinhibited Formin mDia1 Structure [X-RAY DIFFRACTION]
Predicted Effect unknown
Transcript: ENSMUST00000025337
AA Change: H344Q
SMART Domains Protein: ENSMUSP00000025337
Gene: ENSMUSG00000024456
AA Change: H344Q

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Drf_GBD 84 268 1.07e-57 SMART
Drf_FH3 274 466 2.06e-68 SMART
coiled coil region 471 571 N/A INTRINSIC
Pfam:Drf_FH1 609 756 6.1e-43 PFAM
FH2 761 1206 2.46e-182 SMART
Predicted Effect unknown
Transcript: ENSMUST00000080033
AA Change: H335Q
SMART Domains Protein: ENSMUSP00000078942
Gene: ENSMUSG00000024456
AA Change: H335Q

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Drf_GBD 75 259 1.07e-57 SMART
Drf_FH3 265 457 2.06e-68 SMART
coiled coil region 462 562 N/A INTRINSIC
Pfam:Drf_FH1 589 747 7.9e-52 PFAM
FH2 752 1197 3.73e-182 SMART
Predicted Effect unknown
Transcript: ENSMUST00000115629
AA Change: H300Q
SMART Domains Protein: ENSMUSP00000111292
Gene: ENSMUSG00000024456
AA Change: H300Q

DomainStartEndE-ValueType
Drf_GBD 40 224 1.07e-57 SMART
Drf_FH3 230 422 2.06e-68 SMART
coiled coil region 427 527 N/A INTRINSIC
Pfam:Drf_FH1 554 712 7.6e-52 PFAM
FH2 717 1162 3.73e-182 SMART
Predicted Effect unknown
Transcript: ENSMUST00000115631
AA Change: H300Q
SMART Domains Protein: ENSMUSP00000111294
Gene: ENSMUSG00000024456
AA Change: H300Q

DomainStartEndE-ValueType
Drf_GBD 40 224 1.07e-57 SMART
Drf_FH3 230 422 2.06e-68 SMART
coiled coil region 427 527 N/A INTRINSIC
Pfam:Drf_FH1 554 712 1.1e-51 PFAM
FH2 717 1162 2.46e-182 SMART
Predicted Effect unknown
Transcript: ENSMUST00000115634
AA Change: H335Q
SMART Domains Protein: ENSMUSP00000111297
Gene: ENSMUSG00000024456
AA Change: H335Q

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Drf_GBD 75 259 1.07e-57 SMART
Drf_FH3 265 457 2.06e-68 SMART
coiled coil region 462 562 N/A INTRINSIC
Pfam:Drf_FH1 589 747 9.4e-52 PFAM
FH2 752 1197 2.46e-182 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the formin family of proteins that play important roles in cytoskeletal rearragnement by nucleation of actin filaments. Mice lacking the encoded protein develop age-dependent myeloproliferative defects resembling human myeloproliferative syndrome and myelodysplastic syndromes. Trafficking of T lymphocytes to secondary lymphoid organs and egression of thymocytes from the thymus are impaired in these animals. Lack of the encoded protein in T lymphocytes and thymocytes also reduces chemotaxis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal hematopoiesis, bone marrow cell morphology, spleen morphology, skin physiology, skull morphology, and postnatal growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T C 13: 58,385,096 D20G probably damaging Het
Aasdh T C 5: 76,896,441 T201A probably damaging Het
Abca12 T A 1: 71,263,508 D2184V probably damaging Het
Abcf1 C T 17: 35,959,244 D641N probably benign Het
Adgrv1 C A 13: 81,155,154 probably null Het
Aftph T C 11: 20,709,744 E693G probably damaging Het
Ahnak A G 19: 9,014,120 D4256G probably damaging Het
Arv1 A G 8: 124,730,912 K185R probably damaging Het
Ces4a T A 8: 105,144,992 V258D possibly damaging Het
Col6a5 T C 9: 105,937,307 D502G unknown Het
Dtna G A 18: 23,611,110 V404I probably benign Het
Ephb1 T C 9: 101,984,120 D615G probably damaging Het
Gimap3 A T 6: 48,765,921 I25N probably damaging Het
Hao1 A G 2: 134,501,149 V274A probably benign Het
Hirip3 T C 7: 126,864,149 S426P probably damaging Het
Igkv4-69 T C 6: 69,283,834 D103G probably damaging Het
Kdm8 T C 7: 125,452,658 V141A probably benign Het
Mink1 G T 11: 70,607,435 A553S probably benign Het
Mpl T A 4: 118,457,120 Y60F probably damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo5a C A 9: 75,160,490 R609S probably benign Het
Myo5b A T 18: 74,707,955 H969L probably benign Het
Olfr1388 T C 11: 49,444,241 L130P probably damaging Het
Olfr354 T A 2: 36,907,822 I292N probably damaging Het
Olfr92 G C 17: 37,111,206 Q259E probably damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Prodh2 T A 7: 30,506,500 W207R probably damaging Het
Rfx6 A G 10: 51,719,991 K457E probably damaging Het
Sim1 A G 10: 50,983,695 E551G possibly damaging Het
Soat2 T C 15: 102,160,614 F358S probably damaging Het
Tes3-ps A G 13: 49,493,719 K24E probably benign Het
Txndc16 A G 14: 45,163,040 F335L possibly damaging Het
Unc45b T C 11: 82,922,912 Y382H probably benign Het
Vmn2r60 A G 7: 42,135,663 T100A probably null Het
Vmn2r93 T A 17: 18,305,188 H369Q probably benign Het
Yy1 A G 12: 108,806,592 I265V probably benign Het
Zfp54 A T 17: 21,433,977 K244N probably damaging Het
Other mutations in Diaph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Diaph1 APN 18 37893348 critical splice donor site probably null
IGL01432:Diaph1 APN 18 37897504 missense unknown
IGL01646:Diaph1 APN 18 37893416 critical splice acceptor site probably null
IGL01676:Diaph1 APN 18 37856188 nonsense probably null
IGL01731:Diaph1 APN 18 37853709 critical splice acceptor site probably benign
IGL01921:Diaph1 APN 18 37856208 missense possibly damaging 0.73
IGL02200:Diaph1 APN 18 37890682 missense unknown
IGL02258:Diaph1 APN 18 37853330 missense probably damaging 0.99
IGL02325:Diaph1 APN 18 37853600 missense probably damaging 1.00
IGL03304:Diaph1 APN 18 37854573 missense possibly damaging 0.47
albatross UTSW 18 37853679 nonsense probably null
cucamonga UTSW 18 37896093 critical splice donor site probably null
damselfly UTSW 18 37897550 nonsense probably null
devastator UTSW 18 37896093 critical splice donor site probably null
Guangzhou UTSW 18 37896093 critical splice donor site probably null
seethrough UTSW 18 37889769 missense probably damaging 1.00
sheer UTSW 18 37896093 critical splice donor site probably benign
R0137:Diaph1 UTSW 18 37891849 missense unknown
R0446:Diaph1 UTSW 18 37853590 missense possibly damaging 0.94
R0523:Diaph1 UTSW 18 37856500 missense possibly damaging 0.56
R1433:Diaph1 UTSW 18 37905134 missense unknown
R1532:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1534:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1535:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1536:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1537:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1611:Diaph1 UTSW 18 37900702 missense unknown
R1756:Diaph1 UTSW 18 37854573 missense possibly damaging 0.47
R1771:Diaph1 UTSW 18 37891018 missense unknown
R1812:Diaph1 UTSW 18 37891018 missense unknown
R2121:Diaph1 UTSW 18 37896389 missense unknown
R3710:Diaph1 UTSW 18 37845484 missense probably damaging 1.00
R3891:Diaph1 UTSW 18 37900638 splice site probably benign
R3892:Diaph1 UTSW 18 37900638 splice site probably benign
R4077:Diaph1 UTSW 18 37853583 missense possibly damaging 0.68
R4079:Diaph1 UTSW 18 37853583 missense possibly damaging 0.68
R4771:Diaph1 UTSW 18 37853551 missense probably damaging 1.00
R4815:Diaph1 UTSW 18 37895203 missense unknown
R5242:Diaph1 UTSW 18 37851635 missense probably damaging 1.00
R5294:Diaph1 UTSW 18 37897550 nonsense probably null
R5294:Diaph1 UTSW 18 37897580 missense unknown
R5349:Diaph1 UTSW 18 37891072 missense unknown
R5427:Diaph1 UTSW 18 37890595 missense unknown
R5623:Diaph1 UTSW 18 37896093 critical splice donor site probably benign
R5677:Diaph1 UTSW 18 37855951 missense probably damaging 1.00
R5730:Diaph1 UTSW 18 37903776 missense unknown
R5767:Diaph1 UTSW 18 37853355 missense probably damaging 1.00
R5925:Diaph1 UTSW 18 37891935 missense unknown
R6151:Diaph1 UTSW 18 37853353 missense probably damaging 1.00
R6823:Diaph1 UTSW 18 37876383 intron probably null
R6925:Diaph1 UTSW 18 37853679 nonsense probably null
R6983:Diaph1 UTSW 18 37889769 missense probably damaging 1.00
R7073:Diaph1 UTSW 18 37889814 critical splice acceptor site probably null
R7248:Diaph1 UTSW 18 37889776 missense probably benign 0.26
R7400:Diaph1 UTSW 18 37854502 missense probably damaging 1.00
R7497:Diaph1 UTSW 18 37895300 critical splice acceptor site probably null
R7544:Diaph1 UTSW 18 37893269 intron probably null
R7703:Diaph1 UTSW 18 37890809 missense unknown
Predicted Primers PCR Primer
(F):5'- AACACGCACAGCTGTACTTTC -3'
(R):5'- ATCTTTTGTGGAGCTCCAGAATG -3'

Sequencing Primer
(F):5'- ACACGCACAGCTGTACTTTCATATC -3'
(R):5'- TCCTTGTCCATCAGGTTG -3'
Posted On2018-10-18