Mutagenetix > Incidental Mutations

Incidental Mutation 'R6877:Dnah14'

536445

Institutional Source

Beutler Lab

Gene Symbol

Dnah14

Ensembl Gene

ENSMUSG00000047369

Gene Name

dynein, axonemal, heavy chain 14

Synonyms

Dnahc14, Gm980, LOC381311, A230079K17Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.097) question?

Stock #

R6877 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

181576559-181815774 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 181628432 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 1001 (T1001K)

Ref Sequence

ENSEMBL: ENSMUSP00000146843 (fasta)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000208001
AA Change: T1001K

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.2%

Validation Efficiency

94% (47/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl2	T	C	3: 148,817,286	Y1367C	probably damaging	Het
Aqr	A	T	2: 114,116,571	C1043*	probably null	Het
Arhgef17	A	G	7: 100,881,341	S1413P	probably damaging	Het
AU041133	A	G	10: 82,151,571	T352A	probably benign	Het
Bcl7a	A	G	5: 123,351,895	T41A	probably damaging	Het
Btbd10	A	T	7: 113,322,760	F298Y	probably damaging	Het
Ccdc57	G	A	11: 120,873,702	T749I	probably benign	Het
Clcnkb	T	C	4: 141,404,832	N646S	probably benign	Het
Dcst1	T	C	3: 89,350,360	D701G	probably benign	Het
Dnah8	G	T	17: 30,746,959	G2422W	probably damaging	Het
Dyrk2	A	T	10: 118,860,423	I310N	probably damaging	Het
Eif5b	A	T	1: 38,050,239	N1099Y	probably damaging	Het
Elp2	T	A	18: 24,634,976	N762K	probably benign	Het
Esco2	A	G	14: 65,831,045	V272A	probably benign	Het
Fat3	A	C	9: 15,999,268	S1813A	probably benign	Het
Gm5346	T	C	8: 43,625,237	H650R	probably benign	Het
Gm5767	G	A	16: 8,683,309	V10I	unknown	Het
Igf2r	A	G	17: 12,697,341	V1710A	probably damaging	Het
Iqgap3	GGAGAG	GGAG	3: 88,112,771		probably null	Het
Kcnk5	T	C	14: 20,144,716	T185A	possibly damaging	Het
Muc5ac	C	T	7: 141,809,744		probably benign	Het
Nol4	A	T	18: 22,719,129	C460S	probably benign	Het
Olfr1307	T	C	2: 111,944,839	I206V	probably benign	Het
Olfr1513	T	A	14: 52,349,813	I78F	possibly damaging	Het
Ovch2	G	A	7: 107,790,108	A371V	probably benign	Het
Pcdhb4	A	G	18: 37,309,572	D645G	probably damaging	Het
Pcnt	A	C	10: 76,434,017	S207A	possibly damaging	Het
Pex1	A	T	5: 3,635,505	Q1211L	probably benign	Het
Pnn	A	G	12: 59,068,767	E99G	probably damaging	Het
Prkrip1	A	T	5: 136,189,624		probably null	Het
Rnf133	A	G	6: 23,649,487	F191L	probably benign	Het
Scn10a	T	C	9: 119,609,782	T1674A	probably damaging	Het
Sdccag8	G	A	1: 177,011,935	V682M	probably damaging	Het
Spi1	T	C	2: 91,114,396	L162P	probably damaging	Het
Sptan1	C	G	2: 30,030,973	N2432K	probably damaging	Het
Stx2	A	G	5: 128,987,820	V271A	probably benign	Het
Sumf2	G	A	5: 129,850,026	D68N	probably damaging	Het
Tsc22d4	A	G	5: 137,762,593	E92G	possibly damaging	Het
Ube3c	G	T	5: 29,587,318	R37L	probably benign	Het
Ubr5	A	G	15: 38,002,570	S1446P	probably damaging	Het
Veph1	T	C	3: 66,255,084	N51S	probably damaging	Het
Vmn1r82	T	C	7: 12,305,363	F70L	possibly damaging	Het
Vmn2r92	A	G	17: 18,168,822	N466S	probably damaging	Het
Vwf	T	A	6: 125,657,201	V2153D	possibly damaging	Het
Wdyhv1	C	A	15: 58,153,678	P163Q	probably damaging	Het
Yeats2	A	G	16: 20,179,594	T300A	probably benign	Het
Zc3h12d	G	T	10: 7,839,971	R46L	probably damaging	Het
Zfp516	T	C	18: 82,955,791	I38T	probably damaging	Het
Zic5	G	A	14: 122,459,688	T505I	unknown	Het
Zpld1	C	T	16: 55,251,671	G75E	probably damaging	Het

Other mutations in Dnah14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01086:Dnah14	APN	1	181752046	missense	probably benign	0.17
IGL01764:Dnah14	APN	1	181744777	missense	probably benign	0.00
IGL03218:Dnah14	APN	1	181755269	missense	probably benign	0.02
IGL03290:Dnah14	APN	1	181763978	splice site	probably benign
IGL03384:Dnah14	APN	1	181745949	missense	probably benign	0.03
R0009:Dnah14	UTSW	1	181769407	splice site	probably benign
R0125:Dnah14	UTSW	1	181752063	missense	probably damaging	0.99
R0579:Dnah14	UTSW	1	181744747	missense	possibly damaging	0.72
R0973:Dnah14	UTSW	1	181752145	missense	probably damaging	1.00
R0973:Dnah14	UTSW	1	181752145	missense	probably damaging	1.00
R0974:Dnah14	UTSW	1	181752145	missense	probably damaging	1.00
R1609:Dnah14	UTSW	1	181750177	missense	probably damaging	0.97
R1860:Dnah14	UTSW	1	181763960	missense	probably damaging	1.00
R2050:Dnah14	UTSW	1	181752562	missense	probably damaging	1.00
R2974:Dnah14	UTSW	1	181755241	critical splice acceptor site	probably null
R4715:Dnah14	UTSW	1	181757223	missense	probably damaging	1.00
R5076:Dnah14	UTSW	1	181757234	missense	probably benign	0.01
R5424:Dnah14	UTSW	1	181763310	missense	possibly damaging	0.95
R5808:Dnah14	UTSW	1	181741159	missense	possibly damaging	0.72
R5997:Dnah14	UTSW	1	181770105	missense	probably benign	0.00
R6052:Dnah14	UTSW	1	181666487	missense	possibly damaging	0.50
R6061:Dnah14	UTSW	1	181709051	missense	probably damaging	1.00
R6089:Dnah14	UTSW	1	181750154	missense	probably damaging	1.00
R6092:Dnah14	UTSW	1	181621833	missense	probably benign	0.13
R6145:Dnah14	UTSW	1	181666417	missense	probably benign	0.00
R6163:Dnah14	UTSW	1	181666361	missense	probably benign	0.33
R6246:Dnah14	UTSW	1	181680888	missense	probably benign	0.00
R6302:Dnah14	UTSW	1	181601206	missense	possibly damaging	0.96
R6306:Dnah14	UTSW	1	181585024	frame shift	probably null
R6326:Dnah14	UTSW	1	181783556	missense	probably damaging	1.00
R6348:Dnah14	UTSW	1	181626720	missense	possibly damaging	0.83
R6367:Dnah14	UTSW	1	181755386	splice site	probably null
R6376:Dnah14	UTSW	1	181605894	missense	possibly damaging	0.79
R6389:Dnah14	UTSW	1	181651202	critical splice donor site	probably null
R6433:Dnah14	UTSW	1	181651657	missense	probably damaging	0.99
R6454:Dnah14	UTSW	1	181783705	missense	probably damaging	1.00
R6476:Dnah14	UTSW	1	181744768	missense	probably benign	0.26
R6523:Dnah14	UTSW	1	181643621	missense	probably benign	0.00
R6529:Dnah14	UTSW	1	181666469	missense	probably damaging	0.98
R6538:Dnah14	UTSW	1	181584985	missense	unknown
R6546:Dnah14	UTSW	1	181738987	missense	probably damaging	1.00
R6752:Dnah14	UTSW	1	181593452	missense	probably benign	0.07
R6762:Dnah14	UTSW	1	181757259	missense	probably damaging	1.00
R6786:Dnah14	UTSW	1	181641405	missense	probably benign	0.21
R6849:Dnah14	UTSW	1	181808945	missense	probably benign	0.00
R6912:Dnah14	UTSW	1	181750183	missense	possibly damaging	0.83
R6919:Dnah14	UTSW	1	181585066	missense	probably benign	0.04
R6924:Dnah14	UTSW	1	181627952	missense	probably benign	0.04
R6957:Dnah14	UTSW	1	181785175	missense	possibly damaging	0.92
R6980:Dnah14	UTSW	1	181648230	missense	probably benign	0.00
R7018:Dnah14	UTSW	1	181626944	missense	possibly damaging	0.55
R7046:Dnah14	UTSW	1	181623003	missense	probably benign	0.01
R7058:Dnah14	UTSW	1	181698049	missense	probably benign	0.00
R7068:Dnah14	UTSW	1	181769790	missense	probably benign	0.35
R7115:Dnah14	UTSW	1	181720145	missense	probably damaging	1.00
R7130:Dnah14	UTSW	1	181745958	nonsense	probably null
R7165:Dnah14	UTSW	1	181704535	missense	probably benign	0.00
R7169:Dnah14	UTSW	1	181702365	missense	probably benign	0.00
R7184:Dnah14	UTSW	1	181704529	nonsense	probably null
R7232:Dnah14	UTSW	1	181757363	missense	probably damaging	1.00
R7260:Dnah14	UTSW	1	181706744	missense	probably damaging	0.99
R7276:Dnah14	UTSW	1	181685807	missense	probably benign	0.41
R7290:Dnah14	UTSW	1	181628174	missense	probably benign	0.20
R7314:Dnah14	UTSW	1	181785254	splice site	probably null
R7326:Dnah14	UTSW	1	181598403	missense	probably benign	0.02
R7336:Dnah14	UTSW	1	181797734	missense	probably damaging	0.96
R7363:Dnah14	UTSW	1	181690524	splice site	probably null
R7371:Dnah14	UTSW	1	181626885	missense	probably benign	0.05
R7376:Dnah14	UTSW	1	181763402	missense	probably benign	0.03
R7418:Dnah14	UTSW	1	181616742	missense	possibly damaging	0.92
R7473:Dnah14	UTSW	1	181752139	missense	probably damaging	0.99
R7514:Dnah14	UTSW	1	181628067	missense	probably damaging	0.96
R7555:Dnah14	UTSW	1	181770054	missense	probably benign	0.26
R7641:Dnah14	UTSW	1	181707533	missense	probably benign	0.01
R7663:Dnah14	UTSW	1	181752155	splice site	probably null
R7674:Dnah14	UTSW	1	181707533	missense	probably benign	0.01
R7680:Dnah14	UTSW	1	181685800	missense	probably benign	0.15
R7709:Dnah14	UTSW	1	181702484	critical splice donor site	probably null
R7842:Dnah14	UTSW	1	181627898	missense	probably damaging	0.99
R7861:Dnah14	UTSW	1	181616759	missense	probably damaging	1.00
R7988:Dnah14	UTSW	1	181783574	missense	probably damaging	0.97
R8016:Dnah14	UTSW	1	181648311	missense	probably benign	0.05
R8042:Dnah14	UTSW	1	181643631	critical splice donor site	probably null
R8071:Dnah14	UTSW	1	181615894	missense	possibly damaging	0.84
R8086:Dnah14	UTSW	1	181766232	missense	probably damaging	1.00
R8095:Dnah14	UTSW	1	181806032	nonsense	probably null
R8139:Dnah14	UTSW	1	181755288	missense	probably damaging	1.00
R8176:Dnah14	UTSW	1	181657033	missense	probably damaging	0.96
R8193:Dnah14	UTSW	1	181688205	missense	probably damaging	1.00
R8197:Dnah14	UTSW	1	181690101	missense	possibly damaging	0.94
R8209:Dnah14	UTSW	1	181795545	missense	possibly damaging	0.69
R8226:Dnah14	UTSW	1	181795545	missense	possibly damaging	0.69
R8251:Dnah14	UTSW	1	181664865	missense	probably damaging	1.00
R8264:Dnah14	UTSW	1	181744792	missense	probably damaging	0.99
R8284:Dnah14	UTSW	1	181773811	missense	probably benign	0.03
R8289:Dnah14	UTSW	1	181716215	nonsense	probably null
R8323:Dnah14	UTSW	1	181704544	missense	probably benign	0.01
R8442:Dnah14	UTSW	1	181741284	missense	probably damaging	0.97
R8458:Dnah14	UTSW	1	181806012	missense
R8507:Dnah14	UTSW	1	181641414	missense	probably benign	0.02
R8509:Dnah14	UTSW	1	181814655	missense
RF007:Dnah14	UTSW	1	181685809	missense	probably benign	0.00
RF012:Dnah14	UTSW	1	181627898	missense	probably damaging	0.99
Z1176:Dnah14	UTSW	1	181757351	missense	possibly damaging	0.83
Z1177:Dnah14	UTSW	1	181690320	missense	probably benign	0.03
Z1177:Dnah14	UTSW	1	181763334	missense	probably damaging	1.00
Z1177:Dnah14	UTSW	1	181766304	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAATGTGTGCTTCTCCAGGC -3'
(R):5'- ATATCTCTGACTCCCCAGTGG -3'

Sequencing Primer
(F):5'- GCTTCCTACCCACCAGAGG -3'
(R):5'- GGTTTCCTTGCCCATAATTAAAACC -3'

Posted On

2018-10-18