Incidental Mutation 'R6877:Spi1'
ID536447
Institutional Source Beutler Lab
Gene Symbol Spi1
Ensembl Gene ENSMUSG00000002111
Gene Namespleen focus forming virus (SFFV) proviral integration oncogene
SynonymsSfpi-1, Dis-1, Tcfpu1, PU.1, Spi-1, Sfpi1, Tfpu.1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6877 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location91082390-91115756 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91114396 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 162 (L162P)
Ref Sequence ENSEMBL: ENSMUSP00000002180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002180] [ENSMUST00000111430] [ENSMUST00000132741] [ENSMUST00000137942] [ENSMUST00000169776] [ENSMUST00000169852]
PDB Structure PU.1 ETS DOMAIN-DNA COMPLEX [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000002180
AA Change: L162P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000002180
Gene: ENSMUSG00000002111
AA Change: L162P

DomainStartEndE-ValueType
low complexity region 56 73 N/A INTRINSIC
low complexity region 78 85 N/A INTRINSIC
low complexity region 154 167 N/A INTRINSIC
ETS 171 259 9.71e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111430
SMART Domains Protein: ENSMUSP00000107058
Gene: ENSMUSG00000002100

DomainStartEndE-ValueType
IG 24 103 4.86e-2 SMART
low complexity region 131 143 N/A INTRINSIC
IG 167 263 2.81e-7 SMART
IG 373 453 1.25e-4 SMART
IG 463 544 2.48e-8 SMART
IG 554 640 3.16e-1 SMART
IG 659 772 3.91e-6 SMART
FN3 775 858 2.5e-11 SMART
FN3 873 956 7.06e-11 SMART
IG 983 1066 3.3e-4 SMART
FN3 1069 1151 4.38e-7 SMART
IGc2 1196 1263 6.21e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132741
Predicted Effect probably benign
Transcript: ENSMUST00000137942
SMART Domains Protein: ENSMUSP00000119994
Gene: ENSMUSG00000002100

DomainStartEndE-ValueType
IG 3 99 2.81e-7 SMART
low complexity region 135 152 N/A INTRINSIC
IG 209 289 1.25e-4 SMART
IG 299 380 2.48e-8 SMART
IG 390 476 3.16e-1 SMART
IG 495 608 3.91e-6 SMART
FN3 611 694 2.5e-11 SMART
FN3 709 792 7.06e-11 SMART
IG 819 902 3.3e-4 SMART
FN3 905 987 4.38e-7 SMART
IGc2 1032 1099 6.21e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169776
SMART Domains Protein: ENSMUSP00000127070
Gene: ENSMUSG00000002100

DomainStartEndE-ValueType
IG 24 103 4.86e-2 SMART
low complexity region 131 143 N/A INTRINSIC
IG 167 263 2.81e-7 SMART
IG 374 454 1.25e-4 SMART
IG 464 545 2.48e-8 SMART
IG 555 641 3.16e-1 SMART
IG 660 773 3.91e-6 SMART
FN3 776 859 2.5e-11 SMART
FN3 874 957 7.06e-11 SMART
IG 984 1067 3.3e-4 SMART
FN3 1070 1152 4.38e-7 SMART
IGc2 1197 1264 6.21e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169852
SMART Domains Protein: ENSMUSP00000130368
Gene: ENSMUSG00000002111

DomainStartEndE-ValueType
low complexity region 50 63 N/A INTRINSIC
low complexity region 123 133 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 94% (47/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an ETS-domain transcription factor that activates gene expression during myeloid and B-lymphoid cell development. The nuclear protein binds to a purine-rich sequence known as the PU-box found near the promoters of target genes, and regulates their expression in coordination with other transcription factors and cofactors. The protein can also regulate alternative splicing of target genes. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice may exhibit fetal or perinatal lethality, absence of myeloid and B cells, and altered T cell and NK cell development. Mice carrying hypomorphic alleles display impaired B-cell and myeloid development, develop T cell derived lymphomas andacute myeloid leukemia, and die prematurely. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,817,286 Y1367C probably damaging Het
Aqr A T 2: 114,116,571 C1043* probably null Het
Arhgef17 A G 7: 100,881,341 S1413P probably damaging Het
AU041133 A G 10: 82,151,571 T352A probably benign Het
Bcl7a A G 5: 123,351,895 T41A probably damaging Het
Btbd10 A T 7: 113,322,760 F298Y probably damaging Het
Ccdc57 G A 11: 120,873,702 T749I probably benign Het
Clcnkb T C 4: 141,404,832 N646S probably benign Het
Dcst1 T C 3: 89,350,360 D701G probably benign Het
Dnah14 C A 1: 181,628,432 T1001K possibly damaging Het
Dnah8 G T 17: 30,746,959 G2422W probably damaging Het
Dyrk2 A T 10: 118,860,423 I310N probably damaging Het
Eif5b A T 1: 38,050,239 N1099Y probably damaging Het
Elp2 T A 18: 24,634,976 N762K probably benign Het
Esco2 A G 14: 65,831,045 V272A probably benign Het
Fat3 A C 9: 15,999,268 S1813A probably benign Het
Gm5346 T C 8: 43,625,237 H650R probably benign Het
Gm5767 G A 16: 8,683,309 V10I unknown Het
Igf2r A G 17: 12,697,341 V1710A probably damaging Het
Iqgap3 GGAGAG GGAG 3: 88,112,771 probably null Het
Kcnk5 T C 14: 20,144,716 T185A possibly damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Nol4 A T 18: 22,719,129 C460S probably benign Het
Olfr1307 T C 2: 111,944,839 I206V probably benign Het
Olfr1513 T A 14: 52,349,813 I78F possibly damaging Het
Ovch2 G A 7: 107,790,108 A371V probably benign Het
Pcdhb4 A G 18: 37,309,572 D645G probably damaging Het
Pcnt A C 10: 76,434,017 S207A possibly damaging Het
Pex1 A T 5: 3,635,505 Q1211L probably benign Het
Pnn A G 12: 59,068,767 E99G probably damaging Het
Prkrip1 A T 5: 136,189,624 probably null Het
Rnf133 A G 6: 23,649,487 F191L probably benign Het
Scn10a T C 9: 119,609,782 T1674A probably damaging Het
Sdccag8 G A 1: 177,011,935 V682M probably damaging Het
Sptan1 C G 2: 30,030,973 N2432K probably damaging Het
Stx2 A G 5: 128,987,820 V271A probably benign Het
Sumf2 G A 5: 129,850,026 D68N probably damaging Het
Tsc22d4 A G 5: 137,762,593 E92G possibly damaging Het
Ube3c G T 5: 29,587,318 R37L probably benign Het
Ubr5 A G 15: 38,002,570 S1446P probably damaging Het
Veph1 T C 3: 66,255,084 N51S probably damaging Het
Vmn1r82 T C 7: 12,305,363 F70L possibly damaging Het
Vmn2r92 A G 17: 18,168,822 N466S probably damaging Het
Vwf T A 6: 125,657,201 V2153D possibly damaging Het
Wdyhv1 C A 15: 58,153,678 P163Q probably damaging Het
Yeats2 A G 16: 20,179,594 T300A probably benign Het
Zc3h12d G T 10: 7,839,971 R46L probably damaging Het
Zfp516 T C 18: 82,955,791 I38T probably damaging Het
Zic5 G A 14: 122,459,688 T505I unknown Het
Zpld1 C T 16: 55,251,671 G75E probably damaging Het
Other mutations in Spi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02591:Spi1 APN 2 91096950 start codon destroyed probably null 0.93
R1778:Spi1 UTSW 2 91099522 missense probably damaging 1.00
R1893:Spi1 UTSW 2 91114357 missense probably benign 0.04
R4230:Spi1 UTSW 2 91115335 missense probably damaging 1.00
R5169:Spi1 UTSW 2 91115083 nonsense probably null
R6025:Spi1 UTSW 2 91114340 missense probably benign
R7052:Spi1 UTSW 2 91113340 missense probably damaging 1.00
R8401:Spi1 UTSW 2 91113305 missense probably benign 0.00
R8725:Spi1 UTSW 2 91115171 missense probably damaging 1.00
X0019:Spi1 UTSW 2 91096985 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TATGGACTTCACGCCTGTTC -3'
(R):5'- CGCACTTTGAAATGATGCCTG -3'

Sequencing Primer
(F):5'- GCCTGTTCTTCCCTTTGCAGG -3'
(R):5'- CCTGTACAGGTAGAGAAGCATCC -3'
Posted On2018-10-18