Incidental Mutation 'R6877:Olfr1307'
ID536448
Institutional Source Beutler Lab
Gene Symbol Olfr1307
Ensembl Gene ENSMUSG00000094747
Gene Nameolfactory receptor 1307
SynonymsMOR245-19P, GA_x6K02T2Q125-72988111-72987173
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R6877 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location111930116-111949440 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111944839 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 206 (I206V)
Ref Sequence ENSEMBL: ENSMUSP00000097201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099604] [ENSMUST00000099606]
Predicted Effect probably benign
Transcript: ENSMUST00000099604
AA Change: I206V

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000097199
Gene: ENSMUSG00000094747
AA Change: I206V

DomainStartEndE-ValueType
Pfam:7tm_4 38 311 1.5e-36 PFAM
Pfam:7tm_1 49 295 6.5e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099606
AA Change: I206V

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000097201
Gene: ENSMUSG00000094747
AA Change: I206V

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 2.2e-42 PFAM
Pfam:7tm_1 41 287 6.7e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 94% (47/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,817,286 Y1367C probably damaging Het
Aqr A T 2: 114,116,571 C1043* probably null Het
Arhgef17 A G 7: 100,881,341 S1413P probably damaging Het
AU041133 A G 10: 82,151,571 T352A probably benign Het
Bcl7a A G 5: 123,351,895 T41A probably damaging Het
Btbd10 A T 7: 113,322,760 F298Y probably damaging Het
Ccdc57 G A 11: 120,873,702 T749I probably benign Het
Clcnkb T C 4: 141,404,832 N646S probably benign Het
Dcst1 T C 3: 89,350,360 D701G probably benign Het
Dnah14 C A 1: 181,628,432 T1001K possibly damaging Het
Dnah8 G T 17: 30,746,959 G2422W probably damaging Het
Dyrk2 A T 10: 118,860,423 I310N probably damaging Het
Eif5b A T 1: 38,050,239 N1099Y probably damaging Het
Elp2 T A 18: 24,634,976 N762K probably benign Het
Esco2 A G 14: 65,831,045 V272A probably benign Het
Fat3 A C 9: 15,999,268 S1813A probably benign Het
Gm5346 T C 8: 43,625,237 H650R probably benign Het
Gm5767 G A 16: 8,683,309 V10I unknown Het
Igf2r A G 17: 12,697,341 V1710A probably damaging Het
Iqgap3 GGAGAG GGAG 3: 88,112,771 probably null Het
Kcnk5 T C 14: 20,144,716 T185A possibly damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Nol4 A T 18: 22,719,129 C460S probably benign Het
Olfr1513 T A 14: 52,349,813 I78F possibly damaging Het
Ovch2 G A 7: 107,790,108 A371V probably benign Het
Pcdhb4 A G 18: 37,309,572 D645G probably damaging Het
Pcnt A C 10: 76,434,017 S207A possibly damaging Het
Pex1 A T 5: 3,635,505 Q1211L probably benign Het
Pnn A G 12: 59,068,767 E99G probably damaging Het
Prkrip1 A T 5: 136,189,624 probably null Het
Rnf133 A G 6: 23,649,487 F191L probably benign Het
Scn10a T C 9: 119,609,782 T1674A probably damaging Het
Sdccag8 G A 1: 177,011,935 V682M probably damaging Het
Spi1 T C 2: 91,114,396 L162P probably damaging Het
Sptan1 C G 2: 30,030,973 N2432K probably damaging Het
Stx2 A G 5: 128,987,820 V271A probably benign Het
Sumf2 G A 5: 129,850,026 D68N probably damaging Het
Tsc22d4 A G 5: 137,762,593 E92G possibly damaging Het
Ube3c G T 5: 29,587,318 R37L probably benign Het
Ubr5 A G 15: 38,002,570 S1446P probably damaging Het
Veph1 T C 3: 66,255,084 N51S probably damaging Het
Vmn1r82 T C 7: 12,305,363 F70L possibly damaging Het
Vmn2r92 A G 17: 18,168,822 N466S probably damaging Het
Vwf T A 6: 125,657,201 V2153D possibly damaging Het
Wdyhv1 C A 15: 58,153,678 P163Q probably damaging Het
Yeats2 A G 16: 20,179,594 T300A probably benign Het
Zc3h12d G T 10: 7,839,971 R46L probably damaging Het
Zfp516 T C 18: 82,955,791 I38T probably damaging Het
Zic5 G A 14: 122,459,688 T505I unknown Het
Zpld1 C T 16: 55,251,671 G75E probably damaging Het
Other mutations in Olfr1307
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01501:Olfr1307 APN 2 111944518 makesense probably null
IGL01947:Olfr1307 APN 2 111944994 missense probably benign 0.26
IGL02373:Olfr1307 APN 2 111944833 missense probably benign 0.01
IGL02682:Olfr1307 APN 2 111944940 missense probably damaging 1.00
R0714:Olfr1307 UTSW 2 111944553 missense probably benign 0.01
R1670:Olfr1307 UTSW 2 111944919 missense probably damaging 1.00
R1730:Olfr1307 UTSW 2 111945288 missense probably benign 0.45
R1733:Olfr1307 UTSW 2 111945280 missense probably benign 0.13
R1773:Olfr1307 UTSW 2 111944859 missense possibly damaging 0.55
R1783:Olfr1307 UTSW 2 111945288 missense probably benign 0.45
R2180:Olfr1307 UTSW 2 111945003 missense probably benign 0.39
R2197:Olfr1307 UTSW 2 111945313 missense possibly damaging 0.64
R2207:Olfr1307 UTSW 2 111944925 missense probably damaging 1.00
R2377:Olfr1307 UTSW 2 111944643 missense probably damaging 1.00
R4425:Olfr1307 UTSW 2 111945189 missense probably benign 0.00
R4595:Olfr1307 UTSW 2 111944652 missense possibly damaging 0.86
R4859:Olfr1307 UTSW 2 111944811 missense probably damaging 0.98
R4910:Olfr1307 UTSW 2 111945078 missense possibly damaging 0.69
R5167:Olfr1307 UTSW 2 111945102 missense probably damaging 1.00
R5537:Olfr1307 UTSW 2 111945048 missense probably damaging 1.00
R6328:Olfr1307 UTSW 2 111945394 missense probably null 0.41
R7011:Olfr1307 UTSW 2 111944686 missense probably benign 0.01
R7177:Olfr1307 UTSW 2 111945156 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTATCAAGGTGTGTCGAAGGAG -3'
(R):5'- TTATGAGCCCGAGGACATGC -3'

Sequencing Primer
(F):5'- TGTGTCGAAGGAGATGGCC -3'
(R):5'- CCGAGGACATGCATCTTGTTTTCAG -3'
Posted On2018-10-18