Incidental Mutation 'R6877:Vmn1r82'
ID536464
Institutional Source Beutler Lab
Gene Symbol Vmn1r82
Ensembl Gene ENSMUSG00000058132
Gene Namevomeronasal 1 receptor 82
SynonymsV1rg12
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R6877 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location12300430-12308582 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12305363 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 70 (F70L)
Ref Sequence ENSEMBL: ENSMUSP00000154524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072801] [ENSMUST00000191002] [ENSMUST00000227672]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072801
AA Change: F187L

PolyPhen 2 Score 0.786 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000072580
Gene: ENSMUSG00000058132
AA Change: F187L

DomainStartEndE-ValueType
Pfam:V1R 35 295 1.3e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000191002
AA Change: F188L

PolyPhen 2 Score 0.786 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140782
Gene: ENSMUSG00000058132
AA Change: F188L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:V1R 36 296 8.4e-27 PFAM
Pfam:7tm_1 39 290 2e-5 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000227672
AA Change: F70L

PolyPhen 2 Score 0.786 (Sensitivity: 0.85; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 94% (47/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,817,286 Y1367C probably damaging Het
Aqr A T 2: 114,116,571 C1043* probably null Het
Arhgef17 A G 7: 100,881,341 S1413P probably damaging Het
AU041133 A G 10: 82,151,571 T352A probably benign Het
Bcl7a A G 5: 123,351,895 T41A probably damaging Het
Btbd10 A T 7: 113,322,760 F298Y probably damaging Het
Ccdc57 G A 11: 120,873,702 T749I probably benign Het
Clcnkb T C 4: 141,404,832 N646S probably benign Het
Dcst1 T C 3: 89,350,360 D701G probably benign Het
Dnah14 C A 1: 181,628,432 T1001K possibly damaging Het
Dnah8 G T 17: 30,746,959 G2422W probably damaging Het
Dyrk2 A T 10: 118,860,423 I310N probably damaging Het
Eif5b A T 1: 38,050,239 N1099Y probably damaging Het
Elp2 T A 18: 24,634,976 N762K probably benign Het
Esco2 A G 14: 65,831,045 V272A probably benign Het
Fat3 A C 9: 15,999,268 S1813A probably benign Het
Gm5346 T C 8: 43,625,237 H650R probably benign Het
Gm5767 G A 16: 8,683,309 V10I unknown Het
Igf2r A G 17: 12,697,341 V1710A probably damaging Het
Iqgap3 GGAGAG GGAG 3: 88,112,771 probably null Het
Kcnk5 T C 14: 20,144,716 T185A possibly damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Nol4 A T 18: 22,719,129 C460S probably benign Het
Olfr1307 T C 2: 111,944,839 I206V probably benign Het
Olfr1513 T A 14: 52,349,813 I78F possibly damaging Het
Ovch2 G A 7: 107,790,108 A371V probably benign Het
Pcdhb4 A G 18: 37,309,572 D645G probably damaging Het
Pcnt A C 10: 76,434,017 S207A possibly damaging Het
Pex1 A T 5: 3,635,505 Q1211L probably benign Het
Pnn A G 12: 59,068,767 E99G probably damaging Het
Prkrip1 A T 5: 136,189,624 probably null Het
Rnf133 A G 6: 23,649,487 F191L probably benign Het
Scn10a T C 9: 119,609,782 T1674A probably damaging Het
Sdccag8 G A 1: 177,011,935 V682M probably damaging Het
Spi1 T C 2: 91,114,396 L162P probably damaging Het
Sptan1 C G 2: 30,030,973 N2432K probably damaging Het
Stx2 A G 5: 128,987,820 V271A probably benign Het
Sumf2 G A 5: 129,850,026 D68N probably damaging Het
Tsc22d4 A G 5: 137,762,593 E92G possibly damaging Het
Ube3c G T 5: 29,587,318 R37L probably benign Het
Ubr5 A G 15: 38,002,570 S1446P probably damaging Het
Veph1 T C 3: 66,255,084 N51S probably damaging Het
Vmn2r92 A G 17: 18,168,822 N466S probably damaging Het
Vwf T A 6: 125,657,201 V2153D possibly damaging Het
Wdyhv1 C A 15: 58,153,678 P163Q probably damaging Het
Yeats2 A G 16: 20,179,594 T300A probably benign Het
Zc3h12d G T 10: 7,839,971 R46L probably damaging Het
Zfp516 T C 18: 82,955,791 I38T probably damaging Het
Zic5 G A 14: 122,459,688 T505I unknown Het
Zpld1 C T 16: 55,251,671 G75E probably damaging Het
Other mutations in Vmn1r82
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01509:Vmn1r82 APN 7 12305169 missense probably damaging 0.99
IGL01955:Vmn1r82 APN 7 12305723 unclassified probably null
IGL02267:Vmn1r82 APN 7 12305346 missense probably damaging 1.00
R0336:Vmn1r82 UTSW 7 12305321 missense probably benign 0.26
R2373:Vmn1r82 UTSW 7 12305055 missense probably damaging 0.99
R2849:Vmn1r82 UTSW 7 12305406 missense probably damaging 1.00
R4621:Vmn1r82 UTSW 7 12305336 missense possibly damaging 0.71
R5628:Vmn1r82 UTSW 7 12305278 missense probably damaging 1.00
R6180:Vmn1r82 UTSW 7 12305085 missense probably damaging 0.97
R6263:Vmn1r82 UTSW 7 12305534 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTACATGGGTCCTTCCTGC -3'
(R):5'- ATCCTGGATTACCAAATAAGGCTG -3'

Sequencing Primer
(F):5'- GCTCACTCAGTTGGCCTATGAATC -3'
(R):5'- TAAGGCTGAATATAGAACCATGATGG -3'
Posted On2018-10-18