Incidental Mutation 'R6877:Arhgef17'
ID 536465
Institutional Source Beutler Lab
Gene Symbol Arhgef17
Ensembl Gene ENSMUSG00000032875
Gene Name Rho guanine nucleotide exchange factor (GEF) 17
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6877 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 100869752-100932107 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 100881341 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1413 (S1413P)
Ref Sequence ENSEMBL: ENSMUSP00000102647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107032] [ENSMUST00000209041]
AlphaFold Q80U35
Predicted Effect probably damaging
Transcript: ENSMUST00000107032
AA Change: S1413P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102647
Gene: ENSMUSG00000032875
AA Change: S1413P

DomainStartEndE-ValueType
low complexity region 65 74 N/A INTRINSIC
low complexity region 160 175 N/A INTRINSIC
low complexity region 196 209 N/A INTRINSIC
low complexity region 227 255 N/A INTRINSIC
low complexity region 282 297 N/A INTRINSIC
low complexity region 314 323 N/A INTRINSIC
low complexity region 507 526 N/A INTRINSIC
low complexity region 559 572 N/A INTRINSIC
low complexity region 828 842 N/A INTRINSIC
low complexity region 970 984 N/A INTRINSIC
RhoGEF 1063 1246 9.56e-61 SMART
Blast:PH 1281 1466 4e-88 BLAST
low complexity region 1582 1595 N/A INTRINSIC
low complexity region 1630 1642 N/A INTRINSIC
low complexity region 1646 1657 N/A INTRINSIC
low complexity region 1661 1701 N/A INTRINSIC
low complexity region 1708 1719 N/A INTRINSIC
low complexity region 2033 2040 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175555
Predicted Effect probably benign
Transcript: ENSMUST00000208482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208735
Predicted Effect probably damaging
Transcript: ENSMUST00000209041
AA Change: S404P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.0798 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 94% (47/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,817,286 Y1367C probably damaging Het
Aqr A T 2: 114,116,571 C1043* probably null Het
AU041133 A G 10: 82,151,571 T352A probably benign Het
Bcl7a A G 5: 123,351,895 T41A probably damaging Het
Btbd10 A T 7: 113,322,760 F298Y probably damaging Het
Ccdc57 G A 11: 120,873,702 T749I probably benign Het
Clcnkb T C 4: 141,404,832 N646S probably benign Het
Dcst1 T C 3: 89,350,360 D701G probably benign Het
Dnah14 C A 1: 181,628,432 T1001K possibly damaging Het
Dnah8 G T 17: 30,746,959 G2422W probably damaging Het
Dyrk2 A T 10: 118,860,423 I310N probably damaging Het
Eif5b A T 1: 38,050,239 N1099Y probably damaging Het
Elp2 T A 18: 24,634,976 N762K probably benign Het
Esco2 A G 14: 65,831,045 V272A probably benign Het
Fat3 A C 9: 15,999,268 S1813A probably benign Het
Gm5346 T C 8: 43,625,237 H650R probably benign Het
Gm5767 G A 16: 8,683,309 V10I unknown Het
Igf2r A G 17: 12,697,341 V1710A probably damaging Het
Iqgap3 GGAGAG GGAG 3: 88,112,771 probably null Het
Kcnk5 T C 14: 20,144,716 T185A possibly damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Nol4 A T 18: 22,719,129 C460S probably benign Het
Olfr1307 T C 2: 111,944,839 I206V probably benign Het
Olfr1513 T A 14: 52,349,813 I78F possibly damaging Het
Ovch2 G A 7: 107,790,108 A371V probably benign Het
Pcdhb4 A G 18: 37,309,572 D645G probably damaging Het
Pcnt A C 10: 76,434,017 S207A possibly damaging Het
Pex1 A T 5: 3,635,505 Q1211L probably benign Het
Pnn A G 12: 59,068,767 E99G probably damaging Het
Prkrip1 A T 5: 136,189,624 probably null Het
Rnf133 A G 6: 23,649,487 F191L probably benign Het
Scn10a T C 9: 119,609,782 T1674A probably damaging Het
Sdccag8 G A 1: 177,011,935 V682M probably damaging Het
Spi1 T C 2: 91,114,396 L162P probably damaging Het
Sptan1 C G 2: 30,030,973 N2432K probably damaging Het
Stx2 A G 5: 128,987,820 V271A probably benign Het
Sumf2 G A 5: 129,850,026 D68N probably damaging Het
Tsc22d4 A G 5: 137,762,593 E92G possibly damaging Het
Ube3c G T 5: 29,587,318 R37L probably benign Het
Ubr5 A G 15: 38,002,570 S1446P probably damaging Het
Veph1 T C 3: 66,255,084 N51S probably damaging Het
Vmn1r82 T C 7: 12,305,363 F70L possibly damaging Het
Vmn2r92 A G 17: 18,168,822 N466S probably damaging Het
Vwf T A 6: 125,657,201 V2153D possibly damaging Het
Wdyhv1 C A 15: 58,153,678 P163Q probably damaging Het
Yeats2 A G 16: 20,179,594 T300A probably benign Het
Zc3h12d G T 10: 7,839,971 R46L probably damaging Het
Zfp516 T C 18: 82,955,791 I38T probably damaging Het
Zic5 G A 14: 122,459,688 T505I unknown Het
Zpld1 C T 16: 55,251,671 G75E probably damaging Het
Other mutations in Arhgef17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Arhgef17 APN 7 100929449 missense probably benign
IGL01071:Arhgef17 APN 7 100885700 missense probably damaging 0.99
IGL01882:Arhgef17 APN 7 100878580 nonsense probably null
IGL01995:Arhgef17 APN 7 100928655 missense probably benign 0.02
IGL02213:Arhgef17 APN 7 100890426 missense probably benign
IGL02380:Arhgef17 APN 7 100929443 missense possibly damaging 0.60
IGL02551:Arhgef17 APN 7 100930346 missense probably damaging 1.00
IGL02613:Arhgef17 APN 7 100928896 missense probably damaging 1.00
IGL02643:Arhgef17 APN 7 100883882 missense possibly damaging 0.95
IGL02798:Arhgef17 APN 7 100929626 missense probably benign 0.00
IGL03113:Arhgef17 APN 7 100929731 missense probably benign 0.00
IGL03264:Arhgef17 APN 7 100880013 missense probably benign 0.00
G1Funyon:Arhgef17 UTSW 7 100879659 missense probably benign 0.00
R0064:Arhgef17 UTSW 7 100881354 missense probably benign 0.00
R0189:Arhgef17 UTSW 7 100928850 missense probably damaging 1.00
R0482:Arhgef17 UTSW 7 100880621 missense probably damaging 1.00
R0826:Arhgef17 UTSW 7 100930743 missense probably benign 0.01
R1295:Arhgef17 UTSW 7 100881269 nonsense probably null
R1296:Arhgef17 UTSW 7 100881269 nonsense probably null
R1389:Arhgef17 UTSW 7 100931037 small deletion probably benign
R1466:Arhgef17 UTSW 7 100929659 missense possibly damaging 0.48
R1466:Arhgef17 UTSW 7 100929659 missense possibly damaging 0.48
R1513:Arhgef17 UTSW 7 100930862 missense probably benign
R1539:Arhgef17 UTSW 7 100890473 missense probably damaging 1.00
R1644:Arhgef17 UTSW 7 100929504 missense probably damaging 1.00
R1789:Arhgef17 UTSW 7 100929870 missense probably damaging 1.00
R1861:Arhgef17 UTSW 7 100882268 missense probably damaging 1.00
R1868:Arhgef17 UTSW 7 100878977 missense probably benign
R2009:Arhgef17 UTSW 7 100881781 missense probably damaging 0.98
R2095:Arhgef17 UTSW 7 100881263 missense probably damaging 1.00
R2311:Arhgef17 UTSW 7 100928904 missense probably benign 0.35
R3607:Arhgef17 UTSW 7 100931172 missense probably damaging 1.00
R3882:Arhgef17 UTSW 7 100876454 missense possibly damaging 0.70
R4089:Arhgef17 UTSW 7 100883799 missense probably damaging 1.00
R4420:Arhgef17 UTSW 7 100882308 splice site probably benign
R4536:Arhgef17 UTSW 7 100929854 missense probably damaging 1.00
R4548:Arhgef17 UTSW 7 100931129 missense possibly damaging 0.60
R4616:Arhgef17 UTSW 7 100882485 missense probably damaging 1.00
R5040:Arhgef17 UTSW 7 100876825 missense probably benign 0.17
R5100:Arhgef17 UTSW 7 100881756 missense possibly damaging 0.90
R5233:Arhgef17 UTSW 7 100881369 missense possibly damaging 0.61
R5307:Arhgef17 UTSW 7 100929428 missense probably benign 0.00
R5313:Arhgef17 UTSW 7 100928924 missense probably damaging 0.99
R5643:Arhgef17 UTSW 7 100880011 missense probably damaging 1.00
R5704:Arhgef17 UTSW 7 100881341 missense probably damaging 1.00
R6166:Arhgef17 UTSW 7 100876492 missense probably damaging 1.00
R6417:Arhgef17 UTSW 7 100930062 missense probably damaging 1.00
R6420:Arhgef17 UTSW 7 100930062 missense probably damaging 1.00
R6510:Arhgef17 UTSW 7 100878536 missense probably damaging 0.97
R6888:Arhgef17 UTSW 7 100930820 missense possibly damaging 0.74
R7016:Arhgef17 UTSW 7 100878977 missense probably benign
R7073:Arhgef17 UTSW 7 100929991 nonsense probably null
R7322:Arhgef17 UTSW 7 100877797 missense probably benign 0.01
R7691:Arhgef17 UTSW 7 100929642 missense probably damaging 1.00
R7724:Arhgef17 UTSW 7 100880609 missense probably damaging 1.00
R7728:Arhgef17 UTSW 7 100930068 missense probably benign 0.00
R7829:Arhgef17 UTSW 7 100876845 missense probably benign 0.03
R8036:Arhgef17 UTSW 7 100929855 missense probably damaging 1.00
R8072:Arhgef17 UTSW 7 100881797 missense probably benign 0.04
R8301:Arhgef17 UTSW 7 100879659 missense probably benign 0.00
R8935:Arhgef17 UTSW 7 100878117 missense probably benign 0.03
R8958:Arhgef17 UTSW 7 100929812 missense probably damaging 0.98
R9221:Arhgef17 UTSW 7 100879611 missense possibly damaging 0.78
R9362:Arhgef17 UTSW 7 100930958 missense probably benign 0.12
R9499:Arhgef17 UTSW 7 100876895 missense possibly damaging 0.52
R9593:Arhgef17 UTSW 7 100882802 missense probably damaging 1.00
X0012:Arhgef17 UTSW 7 100928904 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- ACATGAACTCTGGCTCACCC -3'
(R):5'- ATAGTCTTGCTCCCACTTAAGG -3'

Sequencing Primer
(F):5'- GCTCACCCAGCTTCCTCTTGG -3'
(R):5'- CTTAAGGGAAGTGACAGGTCC -3'
Posted On 2018-10-18