Mutagenetix > Incidental Mutation

Incidental Mutation 'R6877:Arhgef17'

536465

Institutional Source

Beutler Lab

Gene Symbol

Arhgef17

Ensembl Gene

ENSMUSG00000032875

Gene Name

Rho guanine nucleotide exchange factor (GEF) 17

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6877 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

100869752-100932107 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 100881341 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1413 (S1413P)

Ref Sequence

ENSEMBL: ENSMUSP00000102647 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107032] [ENSMUST00000209041]

AlphaFold

Q80U35

Predicted Effect

probably damaging
Transcript: ENSMUST00000107032
AA Change: S1413P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000102647
Gene: ENSMUSG00000032875
AA Change: S1413P

Domain	Start	End	E-Value	Type
low complexity region	65	74	N/A	INTRINSIC
low complexity region	160	175	N/A	INTRINSIC
low complexity region	196	209	N/A	INTRINSIC
low complexity region	227	255	N/A	INTRINSIC
low complexity region	282	297	N/A	INTRINSIC
low complexity region	314	323	N/A	INTRINSIC
low complexity region	507	526	N/A	INTRINSIC
low complexity region	559	572	N/A	INTRINSIC
low complexity region	828	842	N/A	INTRINSIC
low complexity region	970	984	N/A	INTRINSIC
RhoGEF	1063	1246	9.56e-61	SMART
Blast:PH	1281	1466	4e-88	BLAST
low complexity region	1582	1595	N/A	INTRINSIC
low complexity region	1630	1642	N/A	INTRINSIC
low complexity region	1646	1657	N/A	INTRINSIC
low complexity region	1661	1701	N/A	INTRINSIC
low complexity region	1708	1719	N/A	INTRINSIC
low complexity region	2033	2040	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175555

Predicted Effect

probably benign
Transcript: ENSMUST00000208482

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208735

Predicted Effect

probably damaging
Transcript: ENSMUST00000209041
AA Change: S404P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

Meta Mutation Damage Score

0.0798

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.2%

Validation Efficiency

94% (47/50)

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl2	T	C	3: 148,817,286	Y1367C	probably damaging	Het
Aqr	A	T	2: 114,116,571	C1043*	probably null	Het
AU041133	A	G	10: 82,151,571	T352A	probably benign	Het
Bcl7a	A	G	5: 123,351,895	T41A	probably damaging	Het
Btbd10	A	T	7: 113,322,760	F298Y	probably damaging	Het
Ccdc57	G	A	11: 120,873,702	T749I	probably benign	Het
Clcnkb	T	C	4: 141,404,832	N646S	probably benign	Het
Dcst1	T	C	3: 89,350,360	D701G	probably benign	Het
Dnah14	C	A	1: 181,628,432	T1001K	possibly damaging	Het
Dnah8	G	T	17: 30,746,959	G2422W	probably damaging	Het
Dyrk2	A	T	10: 118,860,423	I310N	probably damaging	Het
Eif5b	A	T	1: 38,050,239	N1099Y	probably damaging	Het
Elp2	T	A	18: 24,634,976	N762K	probably benign	Het
Esco2	A	G	14: 65,831,045	V272A	probably benign	Het
Fat3	A	C	9: 15,999,268	S1813A	probably benign	Het
Gm5346	T	C	8: 43,625,237	H650R	probably benign	Het
Gm5767	G	A	16: 8,683,309	V10I	unknown	Het
Igf2r	A	G	17: 12,697,341	V1710A	probably damaging	Het
Iqgap3	GGAGAG	GGAG	3: 88,112,771		probably null	Het
Kcnk5	T	C	14: 20,144,716	T185A	possibly damaging	Het
Muc5ac	C	T	7: 141,809,744		probably benign	Het
Nol4	A	T	18: 22,719,129	C460S	probably benign	Het
Olfr1307	T	C	2: 111,944,839	I206V	probably benign	Het
Olfr1513	T	A	14: 52,349,813	I78F	possibly damaging	Het
Ovch2	G	A	7: 107,790,108	A371V	probably benign	Het
Pcdhb4	A	G	18: 37,309,572	D645G	probably damaging	Het
Pcnt	A	C	10: 76,434,017	S207A	possibly damaging	Het
Pex1	A	T	5: 3,635,505	Q1211L	probably benign	Het
Pnn	A	G	12: 59,068,767	E99G	probably damaging	Het
Prkrip1	A	T	5: 136,189,624		probably null	Het
Rnf133	A	G	6: 23,649,487	F191L	probably benign	Het
Scn10a	T	C	9: 119,609,782	T1674A	probably damaging	Het
Sdccag8	G	A	1: 177,011,935	V682M	probably damaging	Het
Spi1	T	C	2: 91,114,396	L162P	probably damaging	Het
Sptan1	C	G	2: 30,030,973	N2432K	probably damaging	Het
Stx2	A	G	5: 128,987,820	V271A	probably benign	Het
Sumf2	G	A	5: 129,850,026	D68N	probably damaging	Het
Tsc22d4	A	G	5: 137,762,593	E92G	possibly damaging	Het
Ube3c	G	T	5: 29,587,318	R37L	probably benign	Het
Ubr5	A	G	15: 38,002,570	S1446P	probably damaging	Het
Veph1	T	C	3: 66,255,084	N51S	probably damaging	Het
Vmn1r82	T	C	7: 12,305,363	F70L	possibly damaging	Het
Vmn2r92	A	G	17: 18,168,822	N466S	probably damaging	Het
Vwf	T	A	6: 125,657,201	V2153D	possibly damaging	Het
Wdyhv1	C	A	15: 58,153,678	P163Q	probably damaging	Het
Yeats2	A	G	16: 20,179,594	T300A	probably benign	Het
Zc3h12d	G	T	10: 7,839,971	R46L	probably damaging	Het
Zfp516	T	C	18: 82,955,791	I38T	probably damaging	Het
Zic5	G	A	14: 122,459,688	T505I	unknown	Het
Zpld1	C	T	16: 55,251,671	G75E	probably damaging	Het

Other mutations in Arhgef17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00844:Arhgef17	APN	7	100929449	missense	probably benign
IGL01071:Arhgef17	APN	7	100885700	missense	probably damaging	0.99
IGL01882:Arhgef17	APN	7	100878580	nonsense	probably null
IGL01995:Arhgef17	APN	7	100928655	missense	probably benign	0.02
IGL02213:Arhgef17	APN	7	100890426	missense	probably benign
IGL02380:Arhgef17	APN	7	100929443	missense	possibly damaging	0.60
IGL02551:Arhgef17	APN	7	100930346	missense	probably damaging	1.00
IGL02613:Arhgef17	APN	7	100928896	missense	probably damaging	1.00
IGL02643:Arhgef17	APN	7	100883882	missense	possibly damaging	0.95
IGL02798:Arhgef17	APN	7	100929626	missense	probably benign	0.00
IGL03113:Arhgef17	APN	7	100929731	missense	probably benign	0.00
IGL03264:Arhgef17	APN	7	100880013	missense	probably benign	0.00
G1Funyon:Arhgef17	UTSW	7	100879659	missense	probably benign	0.00
R0064:Arhgef17	UTSW	7	100881354	missense	probably benign	0.00
R0189:Arhgef17	UTSW	7	100928850	missense	probably damaging	1.00
R0482:Arhgef17	UTSW	7	100880621	missense	probably damaging	1.00
R0826:Arhgef17	UTSW	7	100930743	missense	probably benign	0.01
R1295:Arhgef17	UTSW	7	100881269	nonsense	probably null
R1296:Arhgef17	UTSW	7	100881269	nonsense	probably null
R1389:Arhgef17	UTSW	7	100931037	small deletion	probably benign
R1466:Arhgef17	UTSW	7	100929659	missense	possibly damaging	0.48
R1466:Arhgef17	UTSW	7	100929659	missense	possibly damaging	0.48
R1513:Arhgef17	UTSW	7	100930862	missense	probably benign
R1539:Arhgef17	UTSW	7	100890473	missense	probably damaging	1.00
R1644:Arhgef17	UTSW	7	100929504	missense	probably damaging	1.00
R1789:Arhgef17	UTSW	7	100929870	missense	probably damaging	1.00
R1861:Arhgef17	UTSW	7	100882268	missense	probably damaging	1.00
R1868:Arhgef17	UTSW	7	100878977	missense	probably benign
R2009:Arhgef17	UTSW	7	100881781	missense	probably damaging	0.98
R2095:Arhgef17	UTSW	7	100881263	missense	probably damaging	1.00
R2311:Arhgef17	UTSW	7	100928904	missense	probably benign	0.35
R3607:Arhgef17	UTSW	7	100931172	missense	probably damaging	1.00
R3882:Arhgef17	UTSW	7	100876454	missense	possibly damaging	0.70
R4089:Arhgef17	UTSW	7	100883799	missense	probably damaging	1.00
R4420:Arhgef17	UTSW	7	100882308	splice site	probably benign
R4536:Arhgef17	UTSW	7	100929854	missense	probably damaging	1.00
R4548:Arhgef17	UTSW	7	100931129	missense	possibly damaging	0.60
R4616:Arhgef17	UTSW	7	100882485	missense	probably damaging	1.00
R5040:Arhgef17	UTSW	7	100876825	missense	probably benign	0.17
R5100:Arhgef17	UTSW	7	100881756	missense	possibly damaging	0.90
R5233:Arhgef17	UTSW	7	100881369	missense	possibly damaging	0.61
R5307:Arhgef17	UTSW	7	100929428	missense	probably benign	0.00
R5313:Arhgef17	UTSW	7	100928924	missense	probably damaging	0.99
R5643:Arhgef17	UTSW	7	100880011	missense	probably damaging	1.00
R5704:Arhgef17	UTSW	7	100881341	missense	probably damaging	1.00
R6166:Arhgef17	UTSW	7	100876492	missense	probably damaging	1.00
R6417:Arhgef17	UTSW	7	100930062	missense	probably damaging	1.00
R6420:Arhgef17	UTSW	7	100930062	missense	probably damaging	1.00
R6510:Arhgef17	UTSW	7	100878536	missense	probably damaging	0.97
R6888:Arhgef17	UTSW	7	100930820	missense	possibly damaging	0.74
R7016:Arhgef17	UTSW	7	100878977	missense	probably benign
R7073:Arhgef17	UTSW	7	100929991	nonsense	probably null
R7322:Arhgef17	UTSW	7	100877797	missense	probably benign	0.01
R7691:Arhgef17	UTSW	7	100929642	missense	probably damaging	1.00
R7724:Arhgef17	UTSW	7	100880609	missense	probably damaging	1.00
R7728:Arhgef17	UTSW	7	100930068	missense	probably benign	0.00
R7829:Arhgef17	UTSW	7	100876845	missense	probably benign	0.03
R8036:Arhgef17	UTSW	7	100929855	missense	probably damaging	1.00
R8072:Arhgef17	UTSW	7	100881797	missense	probably benign	0.04
R8301:Arhgef17	UTSW	7	100879659	missense	probably benign	0.00
R8935:Arhgef17	UTSW	7	100878117	missense	probably benign	0.03
R8958:Arhgef17	UTSW	7	100929812	missense	probably damaging	0.98
R9221:Arhgef17	UTSW	7	100879611	missense	possibly damaging	0.78
R9362:Arhgef17	UTSW	7	100930958	missense	probably benign	0.12
R9499:Arhgef17	UTSW	7	100876895	missense	possibly damaging	0.52
R9593:Arhgef17	UTSW	7	100882802	missense	probably damaging	1.00
X0012:Arhgef17	UTSW	7	100928904	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- ACATGAACTCTGGCTCACCC -3'
(R):5'- ATAGTCTTGCTCCCACTTAAGG -3'

Sequencing Primer
(F):5'- GCTCACCCAGCTTCCTCTTGG -3'
(R):5'- CTTAAGGGAAGTGACAGGTCC -3'

Posted On

2018-10-18