Incidental Mutation 'R6877:Esco2'
ID536480
Institutional Source Beutler Lab
Gene Symbol Esco2
Ensembl Gene ENSMUSG00000022034
Gene Nameestablishment of sister chromatid cohesion N-acetyltransferase 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6877 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location65819038-65833994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65831045 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 272 (V272A)
Ref Sequence ENSEMBL: ENSMUSP00000022613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022613] [ENSMUST00000225853]
Predicted Effect probably benign
Transcript: ENSMUST00000022613
AA Change: V272A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000022613
Gene: ENSMUSG00000022034
AA Change: V272A

DomainStartEndE-ValueType
low complexity region 139 156 N/A INTRINSIC
low complexity region 229 243 N/A INTRINSIC
Pfam:zf-C2H2_3 371 410 1.6e-18 PFAM
Pfam:Acetyltransf_13 520 588 2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000225853
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 94% (47/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may have acetyltransferase activity and may be required for the establishment of sister chromatid cohesion during the S phase of mitosis. Mutations in this gene have been associated with Roberts syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality before implantation associated with impaired chromosome cohesion and abnormal mitosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,817,286 Y1367C probably damaging Het
Aqr A T 2: 114,116,571 C1043* probably null Het
Arhgef17 A G 7: 100,881,341 S1413P probably damaging Het
AU041133 A G 10: 82,151,571 T352A probably benign Het
Bcl7a A G 5: 123,351,895 T41A probably damaging Het
Btbd10 A T 7: 113,322,760 F298Y probably damaging Het
Ccdc57 G A 11: 120,873,702 T749I probably benign Het
Clcnkb T C 4: 141,404,832 N646S probably benign Het
Dcst1 T C 3: 89,350,360 D701G probably benign Het
Dnah14 C A 1: 181,628,432 T1001K possibly damaging Het
Dnah8 G T 17: 30,746,959 G2422W probably damaging Het
Dyrk2 A T 10: 118,860,423 I310N probably damaging Het
Eif5b A T 1: 38,050,239 N1099Y probably damaging Het
Elp2 T A 18: 24,634,976 N762K probably benign Het
Fat3 A C 9: 15,999,268 S1813A probably benign Het
Gm5346 T C 8: 43,625,237 H650R probably benign Het
Gm5767 G A 16: 8,683,309 V10I unknown Het
Igf2r A G 17: 12,697,341 V1710A probably damaging Het
Iqgap3 GGAGAG GGAG 3: 88,112,771 probably null Het
Kcnk5 T C 14: 20,144,716 T185A possibly damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Nol4 A T 18: 22,719,129 C460S probably benign Het
Olfr1307 T C 2: 111,944,839 I206V probably benign Het
Olfr1513 T A 14: 52,349,813 I78F possibly damaging Het
Ovch2 G A 7: 107,790,108 A371V probably benign Het
Pcdhb4 A G 18: 37,309,572 D645G probably damaging Het
Pcnt A C 10: 76,434,017 S207A possibly damaging Het
Pex1 A T 5: 3,635,505 Q1211L probably benign Het
Pnn A G 12: 59,068,767 E99G probably damaging Het
Prkrip1 A T 5: 136,189,624 probably null Het
Rnf133 A G 6: 23,649,487 F191L probably benign Het
Scn10a T C 9: 119,609,782 T1674A probably damaging Het
Sdccag8 G A 1: 177,011,935 V682M probably damaging Het
Spi1 T C 2: 91,114,396 L162P probably damaging Het
Sptan1 C G 2: 30,030,973 N2432K probably damaging Het
Stx2 A G 5: 128,987,820 V271A probably benign Het
Sumf2 G A 5: 129,850,026 D68N probably damaging Het
Tsc22d4 A G 5: 137,762,593 E92G possibly damaging Het
Ube3c G T 5: 29,587,318 R37L probably benign Het
Ubr5 A G 15: 38,002,570 S1446P probably damaging Het
Veph1 T C 3: 66,255,084 N51S probably damaging Het
Vmn1r82 T C 7: 12,305,363 F70L possibly damaging Het
Vmn2r92 A G 17: 18,168,822 N466S probably damaging Het
Vwf T A 6: 125,657,201 V2153D possibly damaging Het
Wdyhv1 C A 15: 58,153,678 P163Q probably damaging Het
Yeats2 A G 16: 20,179,594 T300A probably benign Het
Zc3h12d G T 10: 7,839,971 R46L probably damaging Het
Zfp516 T C 18: 82,955,791 I38T probably damaging Het
Zic5 G A 14: 122,459,688 T505I unknown Het
Zpld1 C T 16: 55,251,671 G75E probably damaging Het
Other mutations in Esco2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01569:Esco2 APN 14 65826528 missense probably benign 0.00
IGL01613:Esco2 APN 14 65826595 missense possibly damaging 0.75
IGL02148:Esco2 APN 14 65826595 missense probably benign 0.00
IGL03039:Esco2 APN 14 65831418 missense probably damaging 0.97
PIT4508001:Esco2 UTSW 14 65831465 missense probably damaging 0.99
R0400:Esco2 UTSW 14 65831706 missense possibly damaging 0.73
R0894:Esco2 UTSW 14 65827277 missense probably benign 0.35
R1778:Esco2 UTSW 14 65831262 missense possibly damaging 0.47
R1795:Esco2 UTSW 14 65827277 missense probably benign 0.35
R1962:Esco2 UTSW 14 65831533 missense probably damaging 1.00
R2325:Esco2 UTSW 14 65826578 unclassified probably null
R2357:Esco2 UTSW 14 65826551 missense probably benign 0.32
R2369:Esco2 UTSW 14 65821740 missense probably damaging 1.00
R4659:Esco2 UTSW 14 65826586 missense possibly damaging 0.92
R5648:Esco2 UTSW 14 65831192 missense probably damaging 1.00
R5873:Esco2 UTSW 14 65824191 missense probably benign 0.00
R6782:Esco2 UTSW 14 65820016 missense probably benign 0.00
R7116:Esco2 UTSW 14 65826557 missense probably damaging 1.00
R7572:Esco2 UTSW 14 65831192 missense probably damaging 0.97
R7645:Esco2 UTSW 14 65827181 missense probably benign 0.08
R8055:Esco2 UTSW 14 65831719 missense probably benign 0.20
R8072:Esco2 UTSW 14 65832681 missense probably benign
Z1177:Esco2 UTSW 14 65824936 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AAAGTGGCTCTCCAAACTGTAAAG -3'
(R):5'- AATTATCCAAATTCTCCTCCTCGGG -3'

Sequencing Primer
(F):5'- TGGCTCTCCAAACTGTAAAGAAAATC -3'
(R):5'- TCAAGTTACACTCCAAGGCGG -3'
Posted On2018-10-18