Incidental Mutation 'R6878:Gm14124'
ID536499
Institutional Source Beutler Lab
Gene Symbol Gm14124
Ensembl Gene ENSMUSG00000079008
Gene Namepredicted gene 14124
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R6878 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location150257517-150270300 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 150266486 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 56 (L56F)
Ref Sequence ENSEMBL: ENSMUSP00000105548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109922]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109922
AA Change: L56F

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105548
Gene: ENSMUSG00000079008
AA Change: L56F

DomainStartEndE-ValueType
KRAB 4 66 9.26e-19 SMART
ZnF_C2H2 103 125 7.49e-5 SMART
ZnF_C2H2 131 151 9.46e0 SMART
ZnF_C2H2 159 181 5.9e-3 SMART
ZnF_C2H2 187 209 6.67e-2 SMART
ZnF_C2H2 215 237 4.87e-4 SMART
ZnF_C2H2 243 265 2.82e0 SMART
ZnF_C2H2 271 293 2.2e2 SMART
ZnF_C2H2 299 321 1.4e-4 SMART
ZnF_C2H2 327 349 1.6e-4 SMART
ZnF_C2H2 355 377 1.18e-2 SMART
ZnF_C2H2 383 405 1.38e-3 SMART
ZnF_C2H2 411 433 9.56e1 SMART
ZnF_C2H2 439 461 6.99e-5 SMART
ZnF_C2H2 467 489 2.99e-4 SMART
ZnF_C2H2 495 517 7.78e-3 SMART
ZnF_C2H2 523 545 1.04e-3 SMART
ZnF_C2H2 551 573 1.6e-4 SMART
ZnF_C2H2 579 601 1.18e-2 SMART
ZnF_C2H2 607 629 4.54e-4 SMART
ZnF_C2H2 635 657 4.24e-4 SMART
ZnF_C2H2 663 685 1.2e-3 SMART
ZnF_C2H2 691 713 8.47e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,433,494 N4810K probably benign Het
Arhgap26 A T 18: 39,227,412 I397F probably damaging Het
Arhgap35 A G 7: 16,565,113 V9A probably benign Het
Asl A G 5: 130,024,292 probably null Het
Atg2a T A 19: 6,250,178 L672Q probably damaging Het
B4galt1 T C 4: 40,809,694 D316G probably damaging Het
Bpifb2 A G 2: 153,875,912 probably benign Het
Ccl1 T C 11: 82,179,693 I18V probably benign Het
Cd47 A G 16: 49,910,869 E278G possibly damaging Het
Cilp G A 9: 65,279,847 G1075S probably damaging Het
Eml2 T C 7: 19,200,612 V604A probably benign Het
Fancm A T 12: 65,116,423 R1454* probably null Het
Gm4302 TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA 10: 100,341,499 probably benign Het
Gm4302 CAG CAGAAG 10: 100,341,507 probably benign Het
Gm4302 GCA GCACCA 10: 100,341,515 probably benign Het
Hif1a T C 12: 73,928,281 M147T possibly damaging Het
Hps5 C G 7: 46,783,634 A221P probably damaging Het
Lrrc49 A G 9: 60,680,148 S67P probably damaging Het
Madd T A 2: 91,169,857 N568I probably damaging Het
Meikin T C 11: 54,411,886 S375P possibly damaging Het
Mfsd6 G T 1: 52,708,753 Q318K probably damaging Het
Mis18a A T 16: 90,721,756 I106N probably damaging Het
Myl2 T C 5: 122,105,077 I148T probably benign Het
Myrf T C 19: 10,216,478 Q730R possibly damaging Het
Nf1 T C 11: 79,434,882 L560P probably damaging Het
Npat A G 9: 53,556,599 T285A probably benign Het
Ntrk3 T A 7: 78,304,372 D547V probably benign Het
Obox2 G T 7: 15,397,320 S117I probably benign Het
Olfr1079 A G 2: 86,538,765 L48P probably damaging Het
Parva T A 7: 112,576,449 N226K possibly damaging Het
Pcdha3 T A 18: 36,947,363 L386* probably null Het
Ppip5k1 A G 2: 121,311,936 F1323S probably benign Het
Prkdc T C 16: 15,777,072 V2771A probably benign Het
Prl7c1 T C 13: 27,778,844 T59A possibly damaging Het
Rab15 T C 12: 76,804,483 T20A probably benign Het
Rp1l1 A G 14: 64,031,852 E1629G probably benign Het
Rpap1 A T 2: 119,778,176 L235Q probably damaging Het
Sema3a A T 5: 13,455,544 I91F possibly damaging Het
Snx6 T C 12: 54,763,601 probably null Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Speer4f2 T G 5: 17,375,767 M114R probably damaging Het
Syne1 T C 10: 5,420,388 D264G possibly damaging Het
Tbl1xr1 T G 3: 22,203,204 N410K possibly damaging Het
Tmed7 A T 18: 46,593,465 D74E probably damaging Het
Upk3b T C 5: 136,039,147 V64A probably benign Het
Vmn2r29 A G 7: 7,241,864 V337A probably benign Het
Yy1 C G 12: 108,814,756 P352A probably damaging Het
Zfp873 T C 10: 82,060,695 I457T probably benign Het
Other mutations in Gm14124
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01550:Gm14124 APN 2 150266443 splice site probably benign
R0220:Gm14124 UTSW 2 150268675 missense unknown
R0396:Gm14124 UTSW 2 150268053 missense probably damaging 1.00
R0402:Gm14124 UTSW 2 150269216 missense possibly damaging 0.93
R0446:Gm14124 UTSW 2 150268073 missense possibly damaging 0.71
R0462:Gm14124 UTSW 2 150269202 missense possibly damaging 0.80
R0507:Gm14124 UTSW 2 150268124 missense possibly damaging 0.69
R0605:Gm14124 UTSW 2 150268603 missense unknown
R0838:Gm14124 UTSW 2 150269300 missense possibly damaging 0.74
R1327:Gm14124 UTSW 2 150266150 missense possibly damaging 0.71
R1405:Gm14124 UTSW 2 150267700 nonsense probably null
R1405:Gm14124 UTSW 2 150267700 nonsense probably null
R2114:Gm14124 UTSW 2 150267899 missense unknown
R2140:Gm14124 UTSW 2 150269361 missense probably benign 0.33
R3683:Gm14124 UTSW 2 150268056 missense probably benign 0.41
R3917:Gm14124 UTSW 2 150266119 splice site probably benign
R4084:Gm14124 UTSW 2 150266202 missense possibly damaging 0.85
R4499:Gm14124 UTSW 2 150269442 missense possibly damaging 0.93
R4683:Gm14124 UTSW 2 150266470 missense possibly damaging 0.53
R4762:Gm14124 UTSW 2 150267629 missense possibly damaging 0.53
R4937:Gm14124 UTSW 2 150268760 missense unknown
R5678:Gm14124 UTSW 2 150268505 nonsense probably null
R5696:Gm14124 UTSW 2 150269474 missense possibly damaging 0.52
R5697:Gm14124 UTSW 2 150269474 missense possibly damaging 0.52
R5698:Gm14124 UTSW 2 150269474 missense possibly damaging 0.52
R5769:Gm14124 UTSW 2 150268278 missense possibly damaging 0.87
R5780:Gm14124 UTSW 2 150266219 missense probably benign 0.05
R5973:Gm14124 UTSW 2 150267935 missense unknown
R6662:Gm14124 UTSW 2 150266252 critical splice donor site probably null
R7037:Gm14124 UTSW 2 150266456 missense possibly damaging 0.86
R7081:Gm14124 UTSW 2 150268269 missense possibly damaging 0.66
R7413:Gm14124 UTSW 2 150266161 missense possibly damaging 0.93
R7725:Gm14124 UTSW 2 150268548 missense unknown
R7781:Gm14124 UTSW 2 150267657 missense possibly damaging 0.53
X0022:Gm14124 UTSW 2 150267658 missense possibly damaging 0.53
Z1177:Gm14124 UTSW 2 150268317 missense possibly damaging 0.84
Z1177:Gm14124 UTSW 2 150268324 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGGGTAGAGTGACCTATGATGATGT -3'
(R):5'- CTGGCAATTCTTCAGCATAGC -3'

Sequencing Primer
(F):5'- CTACAGGAATCTCGCTGCTATAGG -3'
(R):5'- GGCAATTCTTCAGCATAGCCCTATTG -3'
Posted On2018-10-18