Incidental Mutation 'R6878:Speer4f2'
ID536504
Institutional Source Beutler Lab
Gene Symbol Speer4f2
Ensembl Gene ENSMUSG00000091827
Gene Namespermatogenesis associated glutamate (E)-rich protein 4f2
SynonymsGm3535, Gm3495
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R6878 (G1)
Quality Score89.0077
Status Not validated
Chromosome5
Chromosomal Location17373180-17378028 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 17375767 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 114 (M114R)
Ref Sequence ENSEMBL: ENSMUSP00000129818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166086]
Predicted Effect probably damaging
Transcript: ENSMUST00000166086
AA Change: M114R

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129818
Gene: ENSMUSG00000091827
AA Change: M114R

DomainStartEndE-ValueType
Pfam:Takusan 34 112 9.6e-20 PFAM
low complexity region 208 253 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,433,494 N4810K probably benign Het
Arhgap26 A T 18: 39,227,412 I397F probably damaging Het
Arhgap35 A G 7: 16,565,113 V9A probably benign Het
Asl A G 5: 130,024,292 probably null Het
Atg2a T A 19: 6,250,178 L672Q probably damaging Het
B4galt1 T C 4: 40,809,694 D316G probably damaging Het
Bpifb2 A G 2: 153,875,912 probably benign Het
Ccl1 T C 11: 82,179,693 I18V probably benign Het
Cd47 A G 16: 49,910,869 E278G possibly damaging Het
Cilp G A 9: 65,279,847 G1075S probably damaging Het
Eml2 T C 7: 19,200,612 V604A probably benign Het
Fancm A T 12: 65,116,423 R1454* probably null Het
Gm14124 C T 2: 150,266,486 L56F possibly damaging Het
Gm4302 TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA 10: 100,341,499 probably benign Het
Gm4302 CAG CAGAAG 10: 100,341,507 probably benign Het
Gm4302 GCA GCACCA 10: 100,341,515 probably benign Het
Hif1a T C 12: 73,928,281 M147T possibly damaging Het
Hps5 C G 7: 46,783,634 A221P probably damaging Het
Lrrc49 A G 9: 60,680,148 S67P probably damaging Het
Madd T A 2: 91,169,857 N568I probably damaging Het
Meikin T C 11: 54,411,886 S375P possibly damaging Het
Mfsd6 G T 1: 52,708,753 Q318K probably damaging Het
Mis18a A T 16: 90,721,756 I106N probably damaging Het
Myl2 T C 5: 122,105,077 I148T probably benign Het
Myrf T C 19: 10,216,478 Q730R possibly damaging Het
Nf1 T C 11: 79,434,882 L560P probably damaging Het
Npat A G 9: 53,556,599 T285A probably benign Het
Ntrk3 T A 7: 78,304,372 D547V probably benign Het
Obox2 G T 7: 15,397,320 S117I probably benign Het
Olfr1079 A G 2: 86,538,765 L48P probably damaging Het
Parva T A 7: 112,576,449 N226K possibly damaging Het
Pcdha3 T A 18: 36,947,363 L386* probably null Het
Ppip5k1 A G 2: 121,311,936 F1323S probably benign Het
Prkdc T C 16: 15,777,072 V2771A probably benign Het
Prl7c1 T C 13: 27,778,844 T59A possibly damaging Het
Rab15 T C 12: 76,804,483 T20A probably benign Het
Rp1l1 A G 14: 64,031,852 E1629G probably benign Het
Rpap1 A T 2: 119,778,176 L235Q probably damaging Het
Sema3a A T 5: 13,455,544 I91F possibly damaging Het
Snx6 T C 12: 54,763,601 probably null Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Syne1 T C 10: 5,420,388 D264G possibly damaging Het
Tbl1xr1 T G 3: 22,203,204 N410K possibly damaging Het
Tmed7 A T 18: 46,593,465 D74E probably damaging Het
Upk3b T C 5: 136,039,147 V64A probably benign Het
Vmn2r29 A G 7: 7,241,864 V337A probably benign Het
Yy1 C G 12: 108,814,756 P352A probably damaging Het
Zfp873 T C 10: 82,060,695 I457T probably benign Het
Other mutations in Speer4f2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01505:Speer4f2 APN 5 17376567 missense possibly damaging 0.94
IGL02092:Speer4f2 APN 5 17376629 nonsense probably null
IGL03100:Speer4f2 APN 5 17376530 missense probably damaging 0.99
R0939:Speer4f2 UTSW 5 17374404 missense probably damaging 0.99
R1384:Speer4f2 UTSW 5 17374449 missense probably damaging 1.00
R1528:Speer4f2 UTSW 5 17376542 missense
R1873:Speer4f2 UTSW 5 17374449 missense probably damaging 1.00
R3608:Speer4f2 UTSW 5 17374494 missense probably benign 0.03
R4972:Speer4f2 UTSW 5 17374425 missense probably benign 0.27
R5421:Speer4f2 UTSW 5 17374358 missense possibly damaging 0.88
R5450:Speer4f2 UTSW 5 17373219 missense possibly damaging 0.85
R5452:Speer4f2 UTSW 5 17376500 missense possibly damaging 0.93
R5531:Speer4f2 UTSW 5 17376528 missense possibly damaging 0.57
R5924:Speer4f2 UTSW 5 17376624 missense probably damaging 1.00
R6454:Speer4f2 UTSW 5 17374433 missense probably damaging 0.99
R6553:Speer4f2 UTSW 5 17374422 missense probably damaging 1.00
R6585:Speer4f2 UTSW 5 17374422 missense probably damaging 1.00
R6649:Speer4f2 UTSW 5 17375769 missense probably benign 0.05
R7089:Speer4f2 UTSW 5 17376663 missense
R7129:Speer4f2 UTSW 5 17377448 missense
R7448:Speer4f2 UTSW 5 17376542 missense
R7654:Speer4f2 UTSW 5 17374415 missense
Predicted Primers PCR Primer
(F):5'- ATGCCTAGCTTCTGACGTTCTG -3'
(R):5'- ATAGAACCAGACCTGCAGGCTC -3'

Sequencing Primer
(F):5'- AGCCAGTTTCCCAAGGTTAAG -3'
(R):5'- AGACCTGCAGGCTCTCCAG -3'
Posted On2018-10-18