Incidental Mutation 'R6878:Arhgap35'
ID536510
Institutional Source Beutler Lab
Gene Symbol Arhgap35
Ensembl Gene ENSMUSG00000058230
Gene NameRho GTPase activating protein 35
Synonymsp190RhoGAP, p190A, Grlf1, P190 RhoGAP, 6430596G11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6878 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location16493719-16614993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16565113 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 9 (V9A)
Ref Sequence ENSEMBL: ENSMUSP00000127379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075845] [ENSMUST00000171937]
Predicted Effect probably benign
Transcript: ENSMUST00000075845
AA Change: V9A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000075242
Gene: ENSMUSG00000058230
AA Change: V9A

DomainStartEndE-ValueType
Pfam:Ras 154 249 6.1e-7 PFAM
FF 270 327 5.76e-9 SMART
FF 369 422 1.1e-5 SMART
FF 429 483 7.43e-12 SMART
FF 485 539 2.02e-4 SMART
Blast:RhoGAP 733 796 1e-7 BLAST
low complexity region 1037 1048 N/A INTRINSIC
low complexity region 1214 1225 N/A INTRINSIC
low complexity region 1227 1235 N/A INTRINSIC
RhoGAP 1259 1433 8.14e-72 SMART
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1462 1494 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171937
AA Change: V9A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000127379
Gene: ENSMUSG00000058230
AA Change: V9A

DomainStartEndE-ValueType
Pfam:Ras 154 249 6e-7 PFAM
FF 270 327 5.76e-9 SMART
FF 369 422 1.1e-5 SMART
FF 429 483 7.43e-12 SMART
FF 485 539 2.02e-4 SMART
Blast:RhoGAP 733 796 1e-7 BLAST
low complexity region 1037 1048 N/A INTRINSIC
low complexity region 1214 1225 N/A INTRINSIC
low complexity region 1227 1235 N/A INTRINSIC
RhoGAP 1259 1433 8.14e-72 SMART
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1462 1494 N/A INTRINSIC
Meta Mutation Damage Score 0.0583 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The human glucocorticoid receptor DNA binding factor, which associates with the promoter region of the glucocorticoid receptor gene (hGR gene), is a repressor of glucocorticoid receptor transcription. The amino acid sequence deduced from the cDNA sequences show the presence of three sequence motifs characteristic of a zinc finger and one motif suggestive of a leucine zipper in which 1 cysteine is found instead of all leucines. The GRLF1 enhances the homologous down-regulation of wild-type hGR gene expression. Biochemical analysis suggests that GRLF1 interaction is sequence specific and that transcriptional efficacy of GRLF1 is regulated through its interaction with specific sequence motif. The level of expression is regulated by glucocorticoids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die within 2 days of birth and never survive beyond 3 weeks. Observed phenotypes include defects in eye morphogenesis, forebrain development, neural tube closure, axon guidance and fasciculation, and renal abnormalities, including hypoplastic and glomerulocystic kidneys, associated with a ciliogenesis defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,433,494 N4810K probably benign Het
Arhgap26 A T 18: 39,227,412 I397F probably damaging Het
Asl A G 5: 130,024,292 probably null Het
Atg2a T A 19: 6,250,178 L672Q probably damaging Het
B4galt1 T C 4: 40,809,694 D316G probably damaging Het
Bpifb2 A G 2: 153,875,912 probably benign Het
Ccl1 T C 11: 82,179,693 I18V probably benign Het
Cd47 A G 16: 49,910,869 E278G possibly damaging Het
Cilp G A 9: 65,279,847 G1075S probably damaging Het
Eml2 T C 7: 19,200,612 V604A probably benign Het
Fancm A T 12: 65,116,423 R1454* probably null Het
Gm14124 C T 2: 150,266,486 L56F possibly damaging Het
Gm4302 TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA 10: 100,341,499 probably benign Het
Gm4302 CAG CAGAAG 10: 100,341,507 probably benign Het
Gm4302 GCA GCACCA 10: 100,341,515 probably benign Het
Hif1a T C 12: 73,928,281 M147T possibly damaging Het
Hps5 C G 7: 46,783,634 A221P probably damaging Het
Lrrc49 A G 9: 60,680,148 S67P probably damaging Het
Madd T A 2: 91,169,857 N568I probably damaging Het
Meikin T C 11: 54,411,886 S375P possibly damaging Het
Mfsd6 G T 1: 52,708,753 Q318K probably damaging Het
Mis18a A T 16: 90,721,756 I106N probably damaging Het
Myl2 T C 5: 122,105,077 I148T probably benign Het
Myrf T C 19: 10,216,478 Q730R possibly damaging Het
Nf1 T C 11: 79,434,882 L560P probably damaging Het
Npat A G 9: 53,556,599 T285A probably benign Het
Ntrk3 T A 7: 78,304,372 D547V probably benign Het
Obox2 G T 7: 15,397,320 S117I probably benign Het
Olfr1079 A G 2: 86,538,765 L48P probably damaging Het
Parva T A 7: 112,576,449 N226K possibly damaging Het
Pcdha3 T A 18: 36,947,363 L386* probably null Het
Ppip5k1 A G 2: 121,311,936 F1323S probably benign Het
Prkdc T C 16: 15,777,072 V2771A probably benign Het
Prl7c1 T C 13: 27,778,844 T59A possibly damaging Het
Rab15 T C 12: 76,804,483 T20A probably benign Het
Rp1l1 A G 14: 64,031,852 E1629G probably benign Het
Rpap1 A T 2: 119,778,176 L235Q probably damaging Het
Sema3a A T 5: 13,455,544 I91F possibly damaging Het
Snx6 T C 12: 54,763,601 probably null Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Speer4f2 T G 5: 17,375,767 M114R probably damaging Het
Syne1 T C 10: 5,420,388 D264G possibly damaging Het
Tbl1xr1 T G 3: 22,203,204 N410K possibly damaging Het
Tmed7 A T 18: 46,593,465 D74E probably damaging Het
Upk3b T C 5: 136,039,147 V64A probably benign Het
Vmn2r29 A G 7: 7,241,864 V337A probably benign Het
Yy1 C G 12: 108,814,756 P352A probably damaging Het
Zfp873 T C 10: 82,060,695 I457T probably benign Het
Other mutations in Arhgap35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Arhgap35 APN 7 16564415 missense probably benign 0.03
IGL00684:Arhgap35 APN 7 16561700 missense possibly damaging 0.93
IGL01385:Arhgap35 APN 7 16564474 missense probably damaging 0.96
IGL01411:Arhgap35 APN 7 16564267 missense probably benign
IGL01922:Arhgap35 APN 7 16564255 missense possibly damaging 0.73
IGL01977:Arhgap35 APN 7 16563203 missense probably damaging 1.00
IGL02074:Arhgap35 APN 7 16563055 missense probably benign 0.19
IGL02305:Arhgap35 APN 7 16563665 missense probably benign 0.15
IGL02342:Arhgap35 APN 7 16562380 missense probably benign 0.12
IGL02973:Arhgap35 APN 7 16562878 missense possibly damaging 0.50
IGL02989:Arhgap35 APN 7 16497655 makesense probably null
PIT4382001:Arhgap35 UTSW 7 16563869 missense possibly damaging 0.95
PIT4431001:Arhgap35 UTSW 7 16561611 missense possibly damaging 0.87
R0047:Arhgap35 UTSW 7 16561992 missense probably benign 0.17
R1690:Arhgap35 UTSW 7 16563281 missense probably damaging 1.00
R1820:Arhgap35 UTSW 7 16561949 missense possibly damaging 0.92
R2036:Arhgap35 UTSW 7 16563133 missense probably damaging 1.00
R2205:Arhgap35 UTSW 7 16498025 splice site probably null
R2292:Arhgap35 UTSW 7 16563551 missense probably damaging 1.00
R3079:Arhgap35 UTSW 7 16562576 missense probably damaging 1.00
R3745:Arhgap35 UTSW 7 16563722 missense probably damaging 1.00
R3762:Arhgap35 UTSW 7 16565075 missense probably damaging 0.98
R4661:Arhgap35 UTSW 7 16564738 missense probably damaging 1.00
R4709:Arhgap35 UTSW 7 16563586 missense probably damaging 0.97
R4749:Arhgap35 UTSW 7 16498626 missense possibly damaging 0.95
R5081:Arhgap35 UTSW 7 16565134 missense possibly damaging 0.71
R5131:Arhgap35 UTSW 7 16511187 splice site probably null
R5175:Arhgap35 UTSW 7 16562599 missense probably damaging 1.00
R5440:Arhgap35 UTSW 7 16562924 missense probably damaging 1.00
R5517:Arhgap35 UTSW 7 16563489 missense probably damaging 1.00
R5987:Arhgap35 UTSW 7 16563467 missense possibly damaging 0.84
R6087:Arhgap35 UTSW 7 16563643 missense probably damaging 1.00
R6139:Arhgap35 UTSW 7 16563467 missense possibly damaging 0.84
R6396:Arhgap35 UTSW 7 16562299 missense probably damaging 0.99
R7063:Arhgap35 UTSW 7 16565113 missense probably benign 0.00
R7150:Arhgap35 UTSW 7 16562566 missense probably damaging 0.96
R7269:Arhgap35 UTSW 7 16561727 missense probably benign
R7276:Arhgap35 UTSW 7 16564568 missense probably damaging 1.00
R7517:Arhgap35 UTSW 7 16562207 missense probably benign 0.31
R7593:Arhgap35 UTSW 7 16564861 missense probably damaging 1.00
R7775:Arhgap35 UTSW 7 16562648 missense probably benign 0.01
R7792:Arhgap35 UTSW 7 16561528 missense possibly damaging 0.88
R8101:Arhgap35 UTSW 7 16562319 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCATTATTGACCACCCGCC -3'
(R):5'- GCAGACATGTTGGCTATTTGGC -3'

Sequencing Primer
(F):5'- GCCCACCAAAGTCACTGG -3'
(R):5'- GTTTGAAGAACTGACATCATACTGG -3'
Posted On2018-10-18