Incidental Mutation 'R6878:Cd47'
ID536535
Institutional Source Beutler Lab
Gene Symbol Cd47
Ensembl Gene ENSMUSG00000055447
Gene NameCD47 antigen (Rh-related antigen, integrin-associated signal transducer)
SynonymsB430305P08Rik, 9130415E20Rik, integrin-associated protein, Itgp, IAP
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6878 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location49800533-49915010 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49910869 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 278 (E278G)
Ref Sequence ENSEMBL: ENSMUSP00000155856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084838] [ENSMUST00000114496] [ENSMUST00000229101] [ENSMUST00000229104] [ENSMUST00000229206] [ENSMUST00000229640] [ENSMUST00000230281] [ENSMUST00000230641] [ENSMUST00000230836]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084838
AA Change: N323D

PolyPhen 2 Score 0.588 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099853
Gene: ENSMUSG00000055447
AA Change: N323D

DomainStartEndE-ValueType
Pfam:V-set_CD47 8 137 2.2e-46 PFAM
Pfam:CD47 163 317 4.7e-62 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000114496
AA Change: N270D
SMART Domains Protein: ENSMUSP00000110140
Gene: ENSMUSG00000055447
AA Change: N270D

DomainStartEndE-ValueType
Pfam:V-set_CD47 1 41 1.8e-15 PFAM
Pfam:CD47 42 199 6.8e-59 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000229101
AA Change: E278G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000229104
Predicted Effect possibly damaging
Transcript: ENSMUST00000229206
AA Change: E321G

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect unknown
Transcript: ENSMUST00000229640
AA Change: N270D
Predicted Effect probably benign
Transcript: ENSMUST00000230281
Predicted Effect possibly damaging
Transcript: ENSMUST00000230641
AA Change: E342G

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000230836
AA Change: N266D

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which is involved in the increase in intracellular calcium concentration that occurs upon cell adhesion to extracellular matrix. The encoded protein is also a receptor for the C-terminal cell binding domain of thrombospondin, and it may play a role in membrane transport and signal transduction. This gene has broad tissue distribution, and is reduced in expression on Rh erythrocytes. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygous mutation of this gene results in a reduced CD3+ fraction of peripheral lymphocytes and inability to clear infection by E.coli. Mutant animals are otherwise normal in appearance, survival, and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,433,494 N4810K probably benign Het
Arhgap26 A T 18: 39,227,412 I397F probably damaging Het
Arhgap35 A G 7: 16,565,113 V9A probably benign Het
Asl A G 5: 130,024,292 probably null Het
Atg2a T A 19: 6,250,178 L672Q probably damaging Het
B4galt1 T C 4: 40,809,694 D316G probably damaging Het
Bpifb2 A G 2: 153,875,912 probably benign Het
Ccl1 T C 11: 82,179,693 I18V probably benign Het
Cilp G A 9: 65,279,847 G1075S probably damaging Het
Eml2 T C 7: 19,200,612 V604A probably benign Het
Fancm A T 12: 65,116,423 R1454* probably null Het
Gm14124 C T 2: 150,266,486 L56F possibly damaging Het
Gm4302 TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA 10: 100,341,499 probably benign Het
Gm4302 CAG CAGAAG 10: 100,341,507 probably benign Het
Gm4302 GCA GCACCA 10: 100,341,515 probably benign Het
Hif1a T C 12: 73,928,281 M147T possibly damaging Het
Hps5 C G 7: 46,783,634 A221P probably damaging Het
Lrrc49 A G 9: 60,680,148 S67P probably damaging Het
Madd T A 2: 91,169,857 N568I probably damaging Het
Meikin T C 11: 54,411,886 S375P possibly damaging Het
Mfsd6 G T 1: 52,708,753 Q318K probably damaging Het
Mis18a A T 16: 90,721,756 I106N probably damaging Het
Myl2 T C 5: 122,105,077 I148T probably benign Het
Myrf T C 19: 10,216,478 Q730R possibly damaging Het
Nf1 T C 11: 79,434,882 L560P probably damaging Het
Npat A G 9: 53,556,599 T285A probably benign Het
Ntrk3 T A 7: 78,304,372 D547V probably benign Het
Obox2 G T 7: 15,397,320 S117I probably benign Het
Olfr1079 A G 2: 86,538,765 L48P probably damaging Het
Parva T A 7: 112,576,449 N226K possibly damaging Het
Pcdha3 T A 18: 36,947,363 L386* probably null Het
Ppip5k1 A G 2: 121,311,936 F1323S probably benign Het
Prkdc T C 16: 15,777,072 V2771A probably benign Het
Prl7c1 T C 13: 27,778,844 T59A possibly damaging Het
Rab15 T C 12: 76,804,483 T20A probably benign Het
Rp1l1 A G 14: 64,031,852 E1629G probably benign Het
Rpap1 A T 2: 119,778,176 L235Q probably damaging Het
Sema3a A T 5: 13,455,544 I91F possibly damaging Het
Snx6 T C 12: 54,763,601 probably null Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Speer4f2 T G 5: 17,375,767 M114R probably damaging Het
Syne1 T C 10: 5,420,388 D264G possibly damaging Het
Tbl1xr1 T G 3: 22,203,204 N410K possibly damaging Het
Tmed7 A T 18: 46,593,465 D74E probably damaging Het
Upk3b T C 5: 136,039,147 V64A probably benign Het
Vmn2r29 A G 7: 7,241,864 V337A probably benign Het
Yy1 C G 12: 108,814,756 P352A probably damaging Het
Zfp873 T C 10: 82,060,695 I457T probably benign Het
Other mutations in Cd47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03253:Cd47 APN 16 49894198 missense probably benign 0.11
R0675:Cd47 UTSW 16 49906799 missense possibly damaging 0.61
R1374:Cd47 UTSW 16 49894180 missense probably damaging 1.00
R1651:Cd47 UTSW 16 49894228 missense possibly damaging 0.93
R1712:Cd47 UTSW 16 49894180 missense probably damaging 1.00
R1803:Cd47 UTSW 16 49867806 missense possibly damaging 0.87
R3720:Cd47 UTSW 16 49867842 missense probably benign 0.09
R3722:Cd47 UTSW 16 49867842 missense probably benign 0.09
R4525:Cd47 UTSW 16 49867792 missense probably benign 0.15
R5366:Cd47 UTSW 16 49896373 missense probably damaging 1.00
R7219:Cd47 UTSW 16 49908077 missense possibly damaging 0.50
R7470:Cd47 UTSW 16 49884222 missense
R8068:Cd47 UTSW 16 49895416 missense
R8554:Cd47 UTSW 16 49867941 missense probably benign 0.00
R8772:Cd47 UTSW 16 49884212 missense
Predicted Primers PCR Primer
(F):5'- CTGAAAAGGCTAATGATTTGCCTG -3'
(R):5'- GCCCCTAGTTGAGTAGAAACAATAG -3'

Sequencing Primer
(F):5'- AGGCTAATGATTTGCCTGATTTC -3'
(R):5'- GGGATTCCAATTGGTTACACAGCAC -3'
Posted On2018-10-18