Incidental Mutation 'R6879:Slc13a3'
ID536548
Institutional Source Beutler Lab
Gene Symbol Slc13a3
Ensembl Gene ENSMUSG00000018459
Gene Namesolute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3
SynonymsSDCT2, NaDC-3, NaDC3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6879 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location165405028-165473230 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 165430301 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 274 (G274V)
Ref Sequence ENSEMBL: ENSMUSP00000029208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029208] [ENSMUST00000109279]
Predicted Effect probably damaging
Transcript: ENSMUST00000029208
AA Change: G274V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029208
Gene: ENSMUSG00000018459
AA Change: G274V

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 9 571 2.6e-110 PFAM
Pfam:CitMHS 43 167 1.4e-15 PFAM
Pfam:CitMHS 221 486 5.3e-18 PFAM
low complexity region 578 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109279
SMART Domains Protein: ENSMUSP00000104902
Gene: ENSMUSG00000018459

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 9 270 6.7e-49 PFAM
Pfam:Na_sulph_symp 265 529 1.9e-51 PFAM
low complexity region 536 554 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian sodium-dicarboxylate cotransporters transport succinate and other Krebs cycle intermediates. They fall into 2 categories based on their substrate affinity: low affinity and high affinity. Both the low- and high-affinity transporters play an important role in the handling of citrate by the kidneys. The protein encoded by this gene represents the high-affinity form. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, although the full-length nature of some of them have not been characterized yet. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat3 A G 10: 80,606,787 D153G probably damaging Het
Agap1 A T 1: 89,766,455 I492F probably benign Het
Arhgap31 G A 16: 38,602,314 T1130I probably benign Het
Atg2a T A 19: 6,251,852 C923S possibly damaging Het
B3gnt8 C A 7: 25,628,852 Q236K probably benign Het
Bptf T G 11: 107,042,690 I261L probably benign Het
Cacna1s T C 1: 136,115,959 F1592S probably benign Het
Catspere2 A T 1: 178,098,772 T335S possibly damaging Het
Cops7a A T 6: 124,958,785 probably null Het
Defb10 A G 8: 21,861,882 I48V probably benign Het
Gabrg3 A C 7: 57,381,639 L51R probably damaging Het
Gins2 G A 8: 120,586,111 T96M probably damaging Het
Gm11568 A G 11: 99,858,227 Q86R unknown Het
Gm14548 A T 7: 3,896,962 S214T probably benign Het
Il33 T C 19: 29,958,962 V224A probably damaging Het
Kcnh3 C A 15: 99,238,167 Q682K probably damaging Het
Kif19a A G 11: 114,781,333 I249V probably benign Het
Kif26a T C 12: 112,177,653 V1447A probably benign Het
Klhdc10 T A 6: 30,449,590 M217K probably damaging Het
Mcc T C 18: 44,812,112 S18G unknown Het
Mical1 A T 10: 41,484,519 Q651H probably damaging Het
Mpdz G A 4: 81,348,656 T340I possibly damaging Het
Olfr1443 T C 19: 12,680,771 I221T probably benign Het
Olfr771 T G 10: 129,160,979 K2Q probably benign Het
Plekha6 A T 1: 133,260,055 M105L possibly damaging Het
Ppp4r4 T A 12: 103,551,920 probably null Het
Samd12 T C 15: 53,658,430 N128S probably benign Het
Six6 A G 12: 72,940,524 K157E probably benign Het
Slc25a54 T A 3: 109,112,834 V388E possibly damaging Het
Smad2 A G 18: 76,262,654 T55A possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spats2 T C 15: 99,173,412 V39A probably damaging Het
Stk32b A G 5: 37,490,523 I167T possibly damaging Het
Taf1b T A 12: 24,500,517 C34S possibly damaging Het
Tex2 T C 11: 106,534,010 E812G unknown Het
Tlcd2 T A 11: 75,469,688 W186R probably damaging Het
Txn2 G A 15: 77,919,722 probably benign Het
Uggt2 T C 14: 119,001,859 K1387R probably benign Het
Unc79 T A 12: 103,148,787 probably null Het
Usp21 T C 1: 171,282,503 D538G probably damaging Het
Zfp109 C T 7: 24,229,190 E265K probably benign Het
Zfp263 A G 16: 3,749,855 H390R probably damaging Het
Other mutations in Slc13a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Slc13a3 APN 2 165411923 missense probably damaging 1.00
IGL00326:Slc13a3 APN 2 165473097 missense possibly damaging 0.89
IGL01308:Slc13a3 APN 2 165406780 missense probably damaging 0.99
IGL01668:Slc13a3 APN 2 165430292 missense probably damaging 1.00
IGL02435:Slc13a3 APN 2 165408940 missense possibly damaging 0.95
IGL02551:Slc13a3 APN 2 165424573 missense probably damaging 1.00
IGL02716:Slc13a3 APN 2 165406715 missense unknown
IGL03107:Slc13a3 APN 2 165437307 missense probably benign 0.00
R0114:Slc13a3 UTSW 2 165424581 missense probably damaging 1.00
R0624:Slc13a3 UTSW 2 165411887 missense probably damaging 1.00
R1051:Slc13a3 UTSW 2 165408820 critical splice donor site probably null
R1780:Slc13a3 UTSW 2 165406699 missense unknown
R1782:Slc13a3 UTSW 2 165445519 missense probably benign 0.01
R1994:Slc13a3 UTSW 2 165434064 missense possibly damaging 0.90
R4739:Slc13a3 UTSW 2 165430289 missense possibly damaging 0.91
R4971:Slc13a3 UTSW 2 165448699 missense probably damaging 0.99
R5091:Slc13a3 UTSW 2 165420080 missense probably benign 0.11
R5093:Slc13a3 UTSW 2 165411896 missense probably damaging 1.00
R5826:Slc13a3 UTSW 2 165408956 missense probably benign 0.05
R5894:Slc13a3 UTSW 2 165424623 missense probably benign 0.00
R6239:Slc13a3 UTSW 2 165406697 missense unknown
R6394:Slc13a3 UTSW 2 165434097 missense probably damaging 1.00
R6453:Slc13a3 UTSW 2 165411947 missense possibly damaging 0.94
R6463:Slc13a3 UTSW 2 165445653 missense probably damaging 1.00
R6480:Slc13a3 UTSW 2 165408898 missense probably damaging 1.00
R6525:Slc13a3 UTSW 2 165406747 missense unknown
R7278:Slc13a3 UTSW 2 165445528 missense possibly damaging 0.87
R7340:Slc13a3 UTSW 2 165430290 missense probably benign 0.00
R7404:Slc13a3 UTSW 2 165434064 missense possibly damaging 0.90
R7452:Slc13a3 UTSW 2 165427114 missense probably benign 0.03
R7585:Slc13a3 UTSW 2 165430322 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTTCTTTGCTCAAAGGGCAAC -3'
(R):5'- TGTGGTTCCACTGAGTCAAAGC -3'

Sequencing Primer
(F):5'- CTTTGCTCAAAGGGCAACATGTG -3'
(R):5'- AAGGAAAGGTGCCTTCTGTC -3'
Posted On2018-10-18