Incidental Mutation 'R6879:Stk32b'
ID 536551
Institutional Source Beutler Lab
Gene Symbol Stk32b
Ensembl Gene ENSMUSG00000029123
Gene Name serine/threonine kinase 32B
Synonyms YANK2, 2510009F08Rik, Stk32, STKG6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock # R6879 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 37446825-37717171 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 37490523 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 167 (I167T)
Ref Sequence ENSEMBL: ENSMUSP00000092432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094836]
AlphaFold Q9JJX8
Predicted Effect possibly damaging
Transcript: ENSMUST00000094836
AA Change: I167T

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000092432
Gene: ENSMUSG00000029123
AA Change: I167T

DomainStartEndE-ValueType
S_TKc 23 283 1.18e-84 SMART
low complexity region 323 336 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine-threonine protein kinase. Serine-threonine kinases transfer phosphate molecules to the oxygen atoms of serine and threonine. A genomic deletion affecting this gene has been associated with Ellis-van Creveld syndrome, an autosomal recessive skeletal dysplasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat3 A G 10: 80,606,787 D153G probably damaging Het
Agap1 A T 1: 89,766,455 I492F probably benign Het
Arhgap31 G A 16: 38,602,314 T1130I probably benign Het
Atg2a T A 19: 6,251,852 C923S possibly damaging Het
B3gnt8 C A 7: 25,628,852 Q236K probably benign Het
Bptf T G 11: 107,042,690 I261L probably benign Het
Cacna1s T C 1: 136,115,959 F1592S probably benign Het
Catspere2 A T 1: 178,098,772 T335S possibly damaging Het
Cops7a A T 6: 124,958,785 probably null Het
Defb10 A G 8: 21,861,882 I48V probably benign Het
Gabrg3 A C 7: 57,381,639 L51R probably damaging Het
Gins2 G A 8: 120,586,111 T96M probably damaging Het
Gm11568 A G 11: 99,858,227 Q86R unknown Het
Gm14548 A T 7: 3,896,962 S214T probably benign Het
Il33 T C 19: 29,958,962 V224A probably damaging Het
Kcnh3 C A 15: 99,238,167 Q682K probably damaging Het
Kif19a A G 11: 114,781,333 I249V probably benign Het
Kif26a T C 12: 112,177,653 V1447A probably benign Het
Klhdc10 T A 6: 30,449,590 M217K probably damaging Het
Mcc T C 18: 44,812,112 S18G unknown Het
Mical1 A T 10: 41,484,519 Q651H probably damaging Het
Mpdz G A 4: 81,348,656 T340I possibly damaging Het
Olfr1443 T C 19: 12,680,771 I221T probably benign Het
Olfr771 T G 10: 129,160,979 K2Q probably benign Het
Plekha6 A T 1: 133,260,055 M105L possibly damaging Het
Ppp4r4 T A 12: 103,551,920 probably null Het
Samd12 T C 15: 53,658,430 N128S probably benign Het
Six6 A G 12: 72,940,524 K157E probably benign Het
Slc13a3 C A 2: 165,430,301 G274V probably damaging Het
Slc25a54 T A 3: 109,112,834 V388E possibly damaging Het
Smad2 A G 18: 76,262,654 T55A possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spats2 T C 15: 99,173,412 V39A probably damaging Het
Taf1b T A 12: 24,500,517 C34S possibly damaging Het
Tex2 T C 11: 106,534,010 E812G unknown Het
Tlcd2 T A 11: 75,469,688 W186R probably damaging Het
Txn2 G A 15: 77,919,722 probably benign Het
Uggt2 T C 14: 119,001,859 K1387R probably benign Het
Unc79 T A 12: 103,148,787 probably null Het
Usp21 T C 1: 171,282,503 D538G probably damaging Het
Zfp109 C T 7: 24,229,190 E265K probably benign Het
Zfp263 A G 16: 3,749,855 H390R probably damaging Het
Other mutations in Stk32b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02166:Stk32b APN 5 37499030 splice site probably benign
IGL02525:Stk32b APN 5 37531633 missense probably damaging 1.00
IGL02946:Stk32b APN 5 37531539 splice site probably benign
IGL03277:Stk32b APN 5 37628976 missense probably damaging 0.99
flank UTSW 5 37466781 missense probably damaging 1.00
H8441:Stk32b UTSW 5 37457234 missense probably damaging 1.00
R0042:Stk32b UTSW 5 37716748 missense probably benign 0.09
R0042:Stk32b UTSW 5 37716748 missense probably benign 0.09
R0051:Stk32b UTSW 5 37459596 splice site probably benign
R0051:Stk32b UTSW 5 37459596 splice site probably benign
R0062:Stk32b UTSW 5 37461448 missense probably damaging 1.00
R0062:Stk32b UTSW 5 37461448 missense probably damaging 1.00
R0601:Stk32b UTSW 5 37531566 missense probably damaging 1.00
R0879:Stk32b UTSW 5 37459596 splice site probably benign
R1812:Stk32b UTSW 5 37466758 missense probably damaging 1.00
R1882:Stk32b UTSW 5 37531687 missense possibly damaging 0.91
R1982:Stk32b UTSW 5 37649114 missense probably damaging 0.99
R3899:Stk32b UTSW 5 37457154 missense probably damaging 1.00
R4724:Stk32b UTSW 5 37454934 critical splice donor site probably null
R4885:Stk32b UTSW 5 37466797 missense probably damaging 1.00
R5531:Stk32b UTSW 5 37459734 splice site probably null
R5629:Stk32b UTSW 5 37457232 missense probably damaging 1.00
R6042:Stk32b UTSW 5 37649114 missense probably damaging 0.99
R6610:Stk32b UTSW 5 37448678 missense probably benign 0.04
R6864:Stk32b UTSW 5 37448805 splice site probably null
R7186:Stk32b UTSW 5 37466781 missense probably damaging 1.00
R8317:Stk32b UTSW 5 37454975 missense probably damaging 0.99
R8676:Stk32b UTSW 5 37457159 missense probably benign 0.00
R8795:Stk32b UTSW 5 37649139 missense probably damaging 0.98
R8948:Stk32b UTSW 5 37454997 missense possibly damaging 0.87
R9192:Stk32b UTSW 5 37629000 missense probably damaging 1.00
V1024:Stk32b UTSW 5 37457234 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTACAGAGGGCAGGAATC -3'
(R):5'- CAGATAACATGCGCACAGTG -3'

Sequencing Primer
(F):5'- AGGAATCCTGCTGGGGC -3'
(R):5'- CACATAAAACCAGAATGCAGGTTAG -3'
Posted On 2018-10-18