Incidental Mutation 'R6879:Mical1'
ID536560
Institutional Source Beutler Lab
Gene Symbol Mical1
Ensembl Gene ENSMUSG00000019823
Gene Namemicrotubule associated monooxygenase, calponin and LIM domain containing 1
SynonymsNical
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R6879 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location41476314-41487032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41484519 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 651 (Q651H)
Ref Sequence ENSEMBL: ENSMUSP00000097519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019965] [ENSMUST00000019967] [ENSMUST00000099934] [ENSMUST00000119962] [ENSMUST00000126436] [ENSMUST00000155411]
Predicted Effect probably benign
Transcript: ENSMUST00000019965
SMART Domains Protein: ENSMUSP00000019965
Gene: ENSMUSG00000019822

DomainStartEndE-ValueType
Pfam:Exo_endo_phos 11 272 3.9e-24 PFAM
transmembrane domain 322 344 N/A INTRINSIC
transmembrane domain 353 375 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000019967
AA Change: Q724H

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000019967
Gene: ENSMUSG00000019823
AA Change: Q724H

DomainStartEndE-ValueType
Pfam:FAD_binding_3 84 140 5.5e-8 PFAM
Pfam:FAD_binding_2 86 125 6.1e-6 PFAM
low complexity region 160 171 N/A INTRINSIC
CH 509 606 4.18e-13 SMART
low complexity region 649 666 N/A INTRINSIC
LIM 682 736 2.07e-3 SMART
low complexity region 766 785 N/A INTRINSIC
low complexity region 787 803 N/A INTRINSIC
low complexity region 855 877 N/A INTRINSIC
DUF3585 912 1048 3.07e-44 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099934
AA Change: Q651H

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097519
Gene: ENSMUSG00000019823
AA Change: Q651H

DomainStartEndE-ValueType
PDB:2C4C|B 1 86 5e-49 PDB
low complexity region 87 98 N/A INTRINSIC
PDB:2C4C|B 99 416 N/A PDB
CH 436 533 4.18e-13 SMART
low complexity region 576 593 N/A INTRINSIC
LIM 609 663 2.07e-3 SMART
low complexity region 693 712 N/A INTRINSIC
low complexity region 714 730 N/A INTRINSIC
low complexity region 782 804 N/A INTRINSIC
DUF3585 839 975 3.07e-44 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000119962
AA Change: Q724H

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113783
Gene: ENSMUSG00000019823
AA Change: Q724H

DomainStartEndE-ValueType
Pfam:FAD_binding_3 84 140 7.2e-8 PFAM
Pfam:FAD_binding_2 86 125 3.8e-6 PFAM
low complexity region 160 171 N/A INTRINSIC
CH 509 606 4.18e-13 SMART
low complexity region 649 666 N/A INTRINSIC
LIM 682 736 2.07e-3 SMART
low complexity region 766 785 N/A INTRINSIC
low complexity region 787 803 N/A INTRINSIC
low complexity region 855 877 N/A INTRINSIC
DUF3585 912 1048 3.07e-44 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000126436
AA Change: Q724H

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114969
Gene: ENSMUSG00000019823
AA Change: Q724H

DomainStartEndE-ValueType
Pfam:FAD_binding_3 84 140 1.1e-7 PFAM
Pfam:FAD_binding_2 86 125 3.2e-6 PFAM
low complexity region 160 171 N/A INTRINSIC
CH 509 606 4.18e-13 SMART
low complexity region 649 666 N/A INTRINSIC
LIM 682 736 2.07e-3 SMART
low complexity region 766 785 N/A INTRINSIC
low complexity region 787 803 N/A INTRINSIC
low complexity region 855 877 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155411
SMART Domains Protein: ENSMUSP00000115461
Gene: ENSMUSG00000019822

DomainStartEndE-ValueType
SCOP:d2dnja_ 9 81 2e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that oxidizes methionine residues on actin, thereby promoting depolymerization of actin filaments. This protein interacts with and regulates signalling by NEDD9/CAS-L (neural precursor cell expressed, developmentally down-regulated 9). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat3 A G 10: 80,606,787 D153G probably damaging Het
Agap1 A T 1: 89,766,455 I492F probably benign Het
Arhgap31 G A 16: 38,602,314 T1130I probably benign Het
Atg2a T A 19: 6,251,852 C923S possibly damaging Het
B3gnt8 C A 7: 25,628,852 Q236K probably benign Het
Bptf T G 11: 107,042,690 I261L probably benign Het
Cacna1s T C 1: 136,115,959 F1592S probably benign Het
Catspere2 A T 1: 178,098,772 T335S possibly damaging Het
Cops7a A T 6: 124,958,785 probably null Het
Defb10 A G 8: 21,861,882 I48V probably benign Het
Gabrg3 A C 7: 57,381,639 L51R probably damaging Het
Gins2 G A 8: 120,586,111 T96M probably damaging Het
Gm11568 A G 11: 99,858,227 Q86R unknown Het
Gm14548 A T 7: 3,896,962 S214T probably benign Het
Il33 T C 19: 29,958,962 V224A probably damaging Het
Kcnh3 C A 15: 99,238,167 Q682K probably damaging Het
Kif19a A G 11: 114,781,333 I249V probably benign Het
Kif26a T C 12: 112,177,653 V1447A probably benign Het
Klhdc10 T A 6: 30,449,590 M217K probably damaging Het
Mcc T C 18: 44,812,112 S18G unknown Het
Mpdz G A 4: 81,348,656 T340I possibly damaging Het
Olfr1443 T C 19: 12,680,771 I221T probably benign Het
Olfr771 T G 10: 129,160,979 K2Q probably benign Het
Plekha6 A T 1: 133,260,055 M105L possibly damaging Het
Ppp4r4 T A 12: 103,551,920 probably null Het
Samd12 T C 15: 53,658,430 N128S probably benign Het
Six6 A G 12: 72,940,524 K157E probably benign Het
Slc13a3 C A 2: 165,430,301 G274V probably damaging Het
Slc25a54 T A 3: 109,112,834 V388E possibly damaging Het
Smad2 A G 18: 76,262,654 T55A possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spats2 T C 15: 99,173,412 V39A probably damaging Het
Stk32b A G 5: 37,490,523 I167T possibly damaging Het
Taf1b T A 12: 24,500,517 C34S possibly damaging Het
Tex2 T C 11: 106,534,010 E812G unknown Het
Tlcd2 T A 11: 75,469,688 W186R probably damaging Het
Txn2 G A 15: 77,919,722 probably benign Het
Uggt2 T C 14: 119,001,859 K1387R probably benign Het
Unc79 T A 12: 103,148,787 probably null Het
Usp21 T C 1: 171,282,503 D538G probably damaging Het
Zfp109 C T 7: 24,229,190 E265K probably benign Het
Zfp263 A G 16: 3,749,855 H390R probably damaging Het
Other mutations in Mical1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01455:Mical1 APN 10 41479069 critical splice donor site probably null
IGL01594:Mical1 APN 10 41480329 missense probably damaging 1.00
IGL02065:Mical1 APN 10 41484411 missense possibly damaging 0.55
IGL02321:Mical1 APN 10 41486664 missense possibly damaging 0.52
IGL02323:Mical1 APN 10 41486664 missense possibly damaging 0.52
IGL02324:Mical1 APN 10 41486664 missense possibly damaging 0.52
IGL02327:Mical1 APN 10 41486664 missense possibly damaging 0.52
IGL02416:Mical1 APN 10 41484810 critical splice donor site probably null
IGL02419:Mical1 APN 10 41482277 missense possibly damaging 0.73
IGL03027:Mical1 APN 10 41479505 unclassified probably benign
IGL03087:Mical1 APN 10 41482690 missense probably damaging 1.00
IGL03368:Mical1 APN 10 41479629 missense probably damaging 0.96
IGL03387:Mical1 APN 10 41478199 missense probably damaging 1.00
PIT1430001:Mical1 UTSW 10 41483496 missense possibly damaging 0.55
R0433:Mical1 UTSW 10 41479490 missense probably benign 0.15
R0617:Mical1 UTSW 10 41481315 missense probably damaging 0.97
R0638:Mical1 UTSW 10 41482239 missense probably benign 0.01
R1535:Mical1 UTSW 10 41485211 missense possibly damaging 0.55
R1623:Mical1 UTSW 10 41481393 critical splice donor site probably null
R1712:Mical1 UTSW 10 41480363 missense probably damaging 1.00
R1806:Mical1 UTSW 10 41478214 missense probably damaging 0.96
R1835:Mical1 UTSW 10 41483535 missense probably benign 0.00
R1866:Mical1 UTSW 10 41485470 missense probably benign 0.39
R2134:Mical1 UTSW 10 41482712 missense probably damaging 1.00
R2352:Mical1 UTSW 10 41482233 missense probably benign 0.21
R3740:Mical1 UTSW 10 41479071 missense probably benign 0.01
R4033:Mical1 UTSW 10 41481176 missense probably benign 0.40
R4093:Mical1 UTSW 10 41486937 unclassified probably benign
R4184:Mical1 UTSW 10 41481870 unclassified probably benign
R4194:Mical1 UTSW 10 41481628 missense possibly damaging 0.88
R4659:Mical1 UTSW 10 41486936 unclassified probably benign
R5139:Mical1 UTSW 10 41478415 unclassified probably null
R5173:Mical1 UTSW 10 41484989 missense probably damaging 1.00
R5340:Mical1 UTSW 10 41483431 splice site probably null
R5501:Mical1 UTSW 10 41486079 missense probably benign 0.01
R5560:Mical1 UTSW 10 41478965 missense probably damaging 1.00
R5726:Mical1 UTSW 10 41483696 unclassified probably benign
R5864:Mical1 UTSW 10 41486068 missense possibly damaging 0.88
R5905:Mical1 UTSW 10 41486877 missense probably benign 0.00
R6028:Mical1 UTSW 10 41486877 missense probably benign 0.00
R6047:Mical1 UTSW 10 41481707 critical splice donor site probably null
R6074:Mical1 UTSW 10 41486065 missense probably benign 0.27
R6458:Mical1 UTSW 10 41484735 missense probably benign 0.44
R6966:Mical1 UTSW 10 41479754 missense probably damaging 0.98
R7049:Mical1 UTSW 10 41482250 missense possibly damaging 0.63
R7095:Mical1 UTSW 10 41479210 intron probably null
R7156:Mical1 UTSW 10 41485257 critical splice donor site probably null
R7312:Mical1 UTSW 10 41479776 critical splice donor site probably null
R8021:Mical1 UTSW 10 41482724 missense probably damaging 0.97
R8056:Mical1 UTSW 10 41481172 missense probably damaging 1.00
X0020:Mical1 UTSW 10 41478996 missense probably damaging 1.00
Z1177:Mical1 UTSW 10 41481705 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- AGAATGTTAGACCTGGGCAGTTG -3'
(R):5'- TTAGGTCCACTGCTCGACAC -3'

Sequencing Primer
(F):5'- TGGATCTGGCTGACCCTCTG -3'
(R):5'- ACTGCTCGACACTCAGAGG -3'
Posted On2018-10-18