Mutagenetix > Incidental Mutations

Incidental Mutation 'R6879:Kif26a'

536571

Institutional Source

Beutler Lab

Gene Symbol

Kif26a

Ensembl Gene

ENSMUSG00000021294

Gene Name

kinesin family member 26A

Synonyms

N-11 kinesin

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.831) question?

Stock #

R6879 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

112146208-112181747 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 112177653 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1447 (V1447A)

Ref Sequence

ENSEMBL: ENSMUSP00000119482 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000128402]

Predicted Effect

probably benign
Transcript: ENSMUST00000128402
AA Change: V1447A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000119482
Gene: ENSMUSG00000021294
AA Change: V1447A

Domain	Start	End	E-Value	Type
low complexity region	238	248	N/A	INTRINSIC
low complexity region	279	297	N/A	INTRINSIC
KISc	362	726	9.57e-35	SMART
low complexity region	727	739	N/A	INTRINSIC
low complexity region	740	754	N/A	INTRINSIC
low complexity region	932	957	N/A	INTRINSIC
low complexity region	1005	1012	N/A	INTRINSIC
low complexity region	1044	1054	N/A	INTRINSIC
low complexity region	1084	1095	N/A	INTRINSIC
low complexity region	1328	1360	N/A	INTRINSIC
low complexity region	1458	1471	N/A	INTRINSIC
low complexity region	1477	1493	N/A	INTRINSIC
low complexity region	1519	1538	N/A	INTRINSIC
low complexity region	1574	1587	N/A	INTRINSIC
low complexity region	1664	1675	N/A	INTRINSIC
low complexity region	1699	1713	N/A	INTRINSIC
coiled coil region	1780	1812	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.0%

Validation Efficiency

100% (42/42)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death associated with megacolon and hyperganglionosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adat3	A	G	10: 80,606,787	D153G	probably damaging	Het
Agap1	A	T	1: 89,766,455	I492F	probably benign	Het
Arhgap31	G	A	16: 38,602,314	T1130I	probably benign	Het
Atg2a	T	A	19: 6,251,852	C923S	possibly damaging	Het
B3gnt8	C	A	7: 25,628,852	Q236K	probably benign	Het
Bptf	T	G	11: 107,042,690	I261L	probably benign	Het
Cacna1s	T	C	1: 136,115,959	F1592S	probably benign	Het
Catspere2	A	T	1: 178,098,772	T335S	possibly damaging	Het
Cops7a	A	T	6: 124,958,785		probably null	Het
Defb10	A	G	8: 21,861,882	I48V	probably benign	Het
Gabrg3	A	C	7: 57,381,639	L51R	probably damaging	Het
Gins2	G	A	8: 120,586,111	T96M	probably damaging	Het
Gm11568	A	G	11: 99,858,227	Q86R	unknown	Het
Gm14548	A	T	7: 3,896,962	S214T	probably benign	Het
Il33	T	C	19: 29,958,962	V224A	probably damaging	Het
Kcnh3	C	A	15: 99,238,167	Q682K	probably damaging	Het
Kif19a	A	G	11: 114,781,333	I249V	probably benign	Het
Klhdc10	T	A	6: 30,449,590	M217K	probably damaging	Het
Mcc	T	C	18: 44,812,112	S18G	unknown	Het
Mical1	A	T	10: 41,484,519	Q651H	probably damaging	Het
Mpdz	G	A	4: 81,348,656	T340I	possibly damaging	Het
Olfr1443	T	C	19: 12,680,771	I221T	probably benign	Het
Olfr771	T	G	10: 129,160,979	K2Q	probably benign	Het
Plekha6	A	T	1: 133,260,055	M105L	possibly damaging	Het
Ppp4r4	T	A	12: 103,551,920		probably null	Het
Samd12	T	C	15: 53,658,430	N128S	probably benign	Het
Six6	A	G	12: 72,940,524	K157E	probably benign	Het
Slc13a3	C	A	2: 165,430,301	G274V	probably damaging	Het
Slc25a54	T	A	3: 109,112,834	V388E	possibly damaging	Het
Smad2	A	G	18: 76,262,654	T55A	possibly damaging	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Spats2	T	C	15: 99,173,412	V39A	probably damaging	Het
Stk32b	A	G	5: 37,490,523	I167T	possibly damaging	Het
Taf1b	T	A	12: 24,500,517	C34S	possibly damaging	Het
Tex2	T	C	11: 106,534,010	E812G	unknown	Het
Tlcd2	T	A	11: 75,469,688	W186R	probably damaging	Het
Txn2	G	A	15: 77,919,722		probably benign	Het
Uggt2	T	C	14: 119,001,859	K1387R	probably benign	Het
Unc79	T	A	12: 103,148,787		probably null	Het
Usp21	T	C	1: 171,282,503	D538G	probably damaging	Het
Zfp109	C	T	7: 24,229,190	E265K	probably benign	Het
Zfp263	A	G	16: 3,749,855	H390R	probably damaging	Het

Other mutations in Kif26a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00233:Kif26a	APN	12	112157632	missense	probably damaging	0.97
IGL01734:Kif26a	APN	12	112176828	missense	probably benign	0.23
IGL01916:Kif26a	APN	12	112176894	missense	possibly damaging	0.49
IGL02080:Kif26a	APN	12	112157566	missense	probably damaging	1.00
IGL02138:Kif26a	APN	12	112174850	missense	probably damaging	1.00
IGL02145:Kif26a	APN	12	112176975	missense	probably benign	0.00
IGL02285:Kif26a	APN	12	112157507	missense	probably damaging	1.00
IGL02393:Kif26a	APN	12	112172664	missense	probably damaging	1.00
IGL02445:Kif26a	APN	12	112173743	missense	probably damaging	1.00
IGL02865:Kif26a	APN	12	112177615	nonsense	probably null
IGL03057:Kif26a	APN	12	112175774	nonsense	probably null
IGL03204:Kif26a	APN	12	112174779	missense	probably damaging	1.00
R0013:Kif26a	UTSW	12	112177880	missense	probably benign	0.03
R0034:Kif26a	UTSW	12	112168963	splice site	probably benign
R0089:Kif26a	UTSW	12	112177403	missense	probably damaging	0.98
R0111:Kif26a	UTSW	12	112163337	splice site	probably benign
R0220:Kif26a	UTSW	12	112157390	missense	probably damaging	0.98
R0346:Kif26a	UTSW	12	112179348	missense	probably null	0.09
R0383:Kif26a	UTSW	12	112178076	missense	possibly damaging	0.94
R0478:Kif26a	UTSW	12	112175789	missense	probably damaging	1.00
R0494:Kif26a	UTSW	12	112179471	splice site	probably null
R1163:Kif26a	UTSW	12	112179945	missense	probably benign	0.08
R1450:Kif26a	UTSW	12	112173852	missense	probably damaging	1.00
R1512:Kif26a	UTSW	12	112146955	missense	possibly damaging	0.47
R1616:Kif26a	UTSW	12	112157246	critical splice acceptor site	probably null
R1723:Kif26a	UTSW	12	112173858	missense	possibly damaging	0.67
R1728:Kif26a	UTSW	12	112176785	missense	possibly damaging	0.95
R1729:Kif26a	UTSW	12	112176785	missense	possibly damaging	0.95
R1903:Kif26a	UTSW	12	112175540	missense	probably damaging	1.00
R2283:Kif26a	UTSW	12	112177353	missense	possibly damaging	0.66
R3862:Kif26a	UTSW	12	112179889	missense	probably benign	0.30
R3906:Kif26a	UTSW	12	112176890	missense	probably benign
R4050:Kif26a	UTSW	12	112179916	missense	probably benign	0.08
R4270:Kif26a	UTSW	12	112173414	missense	probably damaging	1.00
R4271:Kif26a	UTSW	12	112173414	missense	probably damaging	1.00
R4731:Kif26a	UTSW	12	112175573	missense	probably benign
R4732:Kif26a	UTSW	12	112175573	missense	probably benign
R4733:Kif26a	UTSW	12	112175573	missense	probably benign
R4908:Kif26a	UTSW	12	112157342	missense	probably damaging	1.00
R4946:Kif26a	UTSW	12	112177794	missense	probably damaging	0.99
R5566:Kif26a	UTSW	12	112157354	missense	probably damaging	1.00
R6280:Kif26a	UTSW	12	112174869	missense	probably damaging	0.99
R6422:Kif26a	UTSW	12	112168875	missense	possibly damaging	0.95
R6513:Kif26a	UTSW	12	112175492	missense	probably damaging	0.97
R6860:Kif26a	UTSW	12	112146829	missense	probably damaging	1.00
R7127:Kif26a	UTSW	12	112178145	missense	probably damaging	1.00
R7366:Kif26a	UTSW	12	112163542	critical splice donor site	probably null
R7595:Kif26a	UTSW	12	112179325	missense	probably benign	0.30
R7630:Kif26a	UTSW	12	112175697	missense	probably damaging	1.00
R7784:Kif26a	UTSW	12	112178147	missense	possibly damaging	0.66
X0027:Kif26a	UTSW	12	112176070	missense	probably benign	0.26

Predicted Primers

PCR Primer
(F):5'- AAGAAGAGTGTTTCTCCCAAGGG -3'
(R):5'- AGAGCCCGAGATGTACTTGG -3'

Sequencing Primer
(F):5'- AAGGGGGCCTTCTTTCCAAG -3'
(R):5'- GAGATGTACTTGGCCCCAGATTAC -3'

Posted On

2018-10-18