Incidental Mutation 'R6879:Kcnh3'
ID536576
Institutional Source Beutler Lab
Gene Symbol Kcnh3
Ensembl Gene ENSMUSG00000037579
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 3
SynonymsElk2, Melk2, C030044P22Rik, ether a go-go like
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6879 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location99224861-99242817 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 99238167 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 682 (Q682K)
Ref Sequence ENSEMBL: ENSMUSP00000040548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041190] [ENSMUST00000041415] [ENSMUST00000163506]
Predicted Effect probably benign
Transcript: ENSMUST00000041190
SMART Domains Protein: ENSMUSP00000043901
Gene: ENSMUSG00000037570

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 81 113 N/A INTRINSIC
Pfam:MCRS_N 134 331 5.7e-98 PFAM
FHA 362 419 2.04e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000041415
AA Change: Q682K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040548
Gene: ENSMUSG00000037579
AA Change: Q682K

DomainStartEndE-ValueType
PAS 20 88 3.94e0 SMART
PAC 94 136 9.92e-6 SMART
low complexity region 148 159 N/A INTRINSIC
Pfam:Ion_trans 224 523 3.8e-34 PFAM
Pfam:Ion_trans_2 453 517 1e-12 PFAM
cNMP 593 708 2.04e-16 SMART
low complexity region 781 800 N/A INTRINSIC
low complexity region 857 872 N/A INTRINSIC
coiled coil region 886 918 N/A INTRINSIC
low complexity region 977 993 N/A INTRINSIC
low complexity region 1022 1035 N/A INTRINSIC
low complexity region 1054 1062 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163506
SMART Domains Protein: ENSMUSP00000131407
Gene: ENSMUSG00000037570

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 68 100 N/A INTRINSIC
Pfam:MCRS_N 121 318 2.4e-97 PFAM
FHA 349 406 2.04e-6 SMART
Meta Mutation Damage Score 0.142 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: The protein encoded by this gene is a voltage-gated potassium channel alpha subunit predominantly expressed in the forebrain. An increase in cognitive function was observed when this gene was knocked out, while deletion of the gene resulted in hippocampal hyperexcitability and epilepsy. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal long term object recognition memory, spatial reference memory, spatial working memory, and long term potentiation. Mice homozygous for a different knock-out allele exhibit neuron hyperexcitability and seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat3 A G 10: 80,606,787 D153G probably damaging Het
Agap1 A T 1: 89,766,455 I492F probably benign Het
Arhgap31 G A 16: 38,602,314 T1130I probably benign Het
Atg2a T A 19: 6,251,852 C923S possibly damaging Het
B3gnt8 C A 7: 25,628,852 Q236K probably benign Het
Bptf T G 11: 107,042,690 I261L probably benign Het
Cacna1s T C 1: 136,115,959 F1592S probably benign Het
Catspere2 A T 1: 178,098,772 T335S possibly damaging Het
Cops7a A T 6: 124,958,785 probably null Het
Defb10 A G 8: 21,861,882 I48V probably benign Het
Gabrg3 A C 7: 57,381,639 L51R probably damaging Het
Gins2 G A 8: 120,586,111 T96M probably damaging Het
Gm11568 A G 11: 99,858,227 Q86R unknown Het
Gm14548 A T 7: 3,896,962 S214T probably benign Het
Il33 T C 19: 29,958,962 V224A probably damaging Het
Kif19a A G 11: 114,781,333 I249V probably benign Het
Kif26a T C 12: 112,177,653 V1447A probably benign Het
Klhdc10 T A 6: 30,449,590 M217K probably damaging Het
Mcc T C 18: 44,812,112 S18G unknown Het
Mical1 A T 10: 41,484,519 Q651H probably damaging Het
Mpdz G A 4: 81,348,656 T340I possibly damaging Het
Olfr1443 T C 19: 12,680,771 I221T probably benign Het
Olfr771 T G 10: 129,160,979 K2Q probably benign Het
Plekha6 A T 1: 133,260,055 M105L possibly damaging Het
Ppp4r4 T A 12: 103,551,920 probably null Het
Samd12 T C 15: 53,658,430 N128S probably benign Het
Six6 A G 12: 72,940,524 K157E probably benign Het
Slc13a3 C A 2: 165,430,301 G274V probably damaging Het
Slc25a54 T A 3: 109,112,834 V388E possibly damaging Het
Smad2 A G 18: 76,262,654 T55A possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spats2 T C 15: 99,173,412 V39A probably damaging Het
Stk32b A G 5: 37,490,523 I167T possibly damaging Het
Taf1b T A 12: 24,500,517 C34S possibly damaging Het
Tex2 T C 11: 106,534,010 E812G unknown Het
Tlcd2 T A 11: 75,469,688 W186R probably damaging Het
Txn2 G A 15: 77,919,722 probably benign Het
Uggt2 T C 14: 119,001,859 K1387R probably benign Het
Unc79 T A 12: 103,148,787 probably null Het
Usp21 T C 1: 171,282,503 D538G probably damaging Het
Zfp109 C T 7: 24,229,190 E265K probably benign Het
Zfp263 A G 16: 3,749,855 H390R probably damaging Het
Other mutations in Kcnh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Kcnh3 APN 15 99242473 missense possibly damaging 0.85
IGL00911:Kcnh3 APN 15 99233001 nonsense probably null
IGL01099:Kcnh3 APN 15 99239736 missense probably benign 0.02
IGL01350:Kcnh3 APN 15 99241992 missense probably benign
IGL01375:Kcnh3 APN 15 99226993 nonsense probably null
IGL01611:Kcnh3 APN 15 99229502 missense probably benign 0.04
IGL01920:Kcnh3 APN 15 99233377 missense probably benign 0.16
IGL02282:Kcnh3 APN 15 99228043 critical splice donor site probably null
IGL02581:Kcnh3 APN 15 99238171 missense possibly damaging 0.72
IGL02889:Kcnh3 APN 15 99227110 missense probably null 0.82
R0427:Kcnh3 UTSW 15 99233299 missense probably benign 0.22
R0532:Kcnh3 UTSW 15 99232963 missense probably damaging 1.00
R0538:Kcnh3 UTSW 15 99240958 missense probably benign 0.00
R0552:Kcnh3 UTSW 15 99229456 missense probably damaging 1.00
R1235:Kcnh3 UTSW 15 99242103 unclassified probably null
R1290:Kcnh3 UTSW 15 99227120 splice site probably null
R1499:Kcnh3 UTSW 15 99239915 missense probably benign 0.00
R1517:Kcnh3 UTSW 15 99238209 missense probably damaging 1.00
R1706:Kcnh3 UTSW 15 99238078 missense possibly damaging 0.86
R1973:Kcnh3 UTSW 15 99229400 missense probably damaging 1.00
R2285:Kcnh3 UTSW 15 99241992 missense probably benign
R3196:Kcnh3 UTSW 15 99233981 missense probably damaging 1.00
R3716:Kcnh3 UTSW 15 99232765 missense possibly damaging 0.52
R4619:Kcnh3 UTSW 15 99234101 missense probably damaging 1.00
R4620:Kcnh3 UTSW 15 99234101 missense probably damaging 1.00
R4624:Kcnh3 UTSW 15 99226372 missense probably damaging 1.00
R4701:Kcnh3 UTSW 15 99241945 missense probably benign
R4853:Kcnh3 UTSW 15 99242089 missense possibly damaging 0.56
R4869:Kcnh3 UTSW 15 99242032 missense probably benign 0.06
R4991:Kcnh3 UTSW 15 99232756 missense probably benign 0.00
R5004:Kcnh3 UTSW 15 99226502 nonsense probably null
R5296:Kcnh3 UTSW 15 99241939 missense probably null 0.92
R5317:Kcnh3 UTSW 15 99227941 missense probably benign
R5338:Kcnh3 UTSW 15 99242394 nonsense probably null
R5658:Kcnh3 UTSW 15 99242076 missense possibly damaging 0.77
R5794:Kcnh3 UTSW 15 99232974 missense probably benign 0.01
R5934:Kcnh3 UTSW 15 99226533 missense possibly damaging 0.46
R6303:Kcnh3 UTSW 15 99227038 missense probably benign 0.37
R6304:Kcnh3 UTSW 15 99227038 missense probably benign 0.37
R6385:Kcnh3 UTSW 15 99227941 missense probably benign
R6466:Kcnh3 UTSW 15 99238243 missense probably damaging 1.00
R6640:Kcnh3 UTSW 15 99241768 missense probably benign 0.08
R6984:Kcnh3 UTSW 15 99228552 missense probably benign 0.00
X0028:Kcnh3 UTSW 15 99242100 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACATCTGGGGCCTCTATCTG -3'
(R):5'- TTAAGTGTGGATTCCTGCCCTG -3'

Sequencing Primer
(F):5'- GGCCTCTATCTGCCCGTG -3'
(R):5'- GGACTTCCGCACAAGCC -3'
Posted On2018-10-18